View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-55 (Length: 595)

Name: J5-7-55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-55
J5-7-55
[»] chr4 (5 HSPs)
chr4 (287-588)||(49276380-49276681)
chr4 (1-292)||(49276685-49276976)
chr4 (288-521)||(49279938-49280171)
chr4 (8-173)||(49280216-49280380)
chr4 (337-457)||(2597808-2597927)
[»] chr5 (1 HSPs)
chr5 (336-457)||(2292655-2292776)
[»] chr6 (1 HSPs)
chr6 (337-447)||(34788428-34788538)
[»] chr7 (1 HSPs)
chr7 (336-387)||(24602196-24602247)


Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 287 - 588
Target Start/End: Original strand, 49276380 - 49276681
Alignment:
287 attaatcaacagataaatatagcgccgccatgaaatcttttcctgatttggaggaacattagatatagctctctcataaacctccctagttttttcctta 386  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49276380 attaatcaacagataaatatagcgccgccatgaaatcttttcctgatttggaggaacattagatatagctctctcataaacctccctagttttttcctta 49276479  T
387 tcccctacactttcttccaatcgtatatattcaaaccaggaatcatagttgaaaggattttccctcacttcgttttcaaataccacaatcttgcatgagt 486  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49276480 tcccctacactttcttccaatcgtatatattcaaaccaggaatcatagttgaaaggattttccctcacttcgttttcaaataccacaatcttgcatgagt 49276579  T
487 aatttaatagcgtgtggnttaagtcatcaacttcaaaaacggaacgtgggcatttttgtttcggagtgcaaattttggtctcttggagntccctagcttc 586  Q
    ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||    
49276580 aatttaatagcgtgtggtttaagtcatcaacttcagaaacggaacgtgggcatttttgtttcggagtgcagattttggtctcttggagttccttagcttc 49276679  T
587 ga 588  Q
    ||    
49276680 ga 49276681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 292
Target Start/End: Original strand, 49276685 - 49276976
Alignment:
1 gaatcttctcagttgtgatttgaattggagcatcggttttgttcttctccattgttggtcgaggaagcttccactgtgtgtcttctctagggaaataact 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49276685 gaatcttctcagttgtgatttgaattggagcatcggttttgttcttctccattgttggtcgaggaagcttccactgtgtgtcttctctagggaaataact 49276784  T
101 cagggtcgagtgagacatggcagaaatcttaaagtgctgtgcgaggaaagaagagttagggctttcgtgacctcagactctcaagacttagggctttcga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49276785 cagggtcgagtgagacatggcagaaatcttaaagtgctgtgcgaggaaagaagagttagggctttcgtgacctcagactctcaagacttagggctttcga 49276884  T
201 taccaaggtcttcagaaacaacgcaggttccatttatagccgactaaannnnnnnnatcacgggccacatccagaatattagctttattaat 292  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||    
49276885 taccaaggtcttcagaaacaacgcaggttccatttatagccgactaaattttttttatcacgggccacatccagaatattagctttattaat 49276976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 167; E-Value: 4e-89
Query Start/End: Original strand, 288 - 521
Target Start/End: Original strand, 49279938 - 49280171
Alignment:
288 ttaatcaacagataaatatagcgccgccatgaaatcttttcctgatttggaggaacattagatatagctctctcataaacctccctagttttttccttat 387  Q
    ||||| |||||| ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
49279938 ttaatgaacagaaaaatatagctccgccaggaaatcttttcctgatttggaggaacattagatatagctctctcataaacctccctagttttttcctcat 49280037  T
388 cccctacactttcttccaatcgtatatattcaaaccaggaatcatagttgaaaggattttccctcacttcgttttcaaataccacaatcttgcatgagta 487  Q
    |||| |||||||||||||||||||||||    ||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||| |||    
49280038 cccccacactttcttccaatcgtatatagcttaaccaggaatcatagttgaaaggattttccctcgcttctttttcaaatgccacaatcttgcatgggta 49280137  T
488 atttaatagcgtgtggnttaagtcatcaacttca 521  Q
    |||||||||||||||| | |||| ||||||||||    
49280138 atttaatagcgtgtggttcaagtaatcaacttca 49280171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 8 - 173
Target Start/End: Original strand, 49280216 - 49280380
Alignment:
8 ctcagttgtgatttgaattggagcatcggttttgttcttctccattgttggtcgaggaagcttccactgtgtgtcttctctagggaaataactcagggtc 107  Q
    ||||||||||||||||||||| |||||||||||||| ||| || |||||||||||||||  |||  ||  ||||||||||||| |  ||||||||||||     
49280216 ctcagttgtgatttgaattggtgcatcggttttgttgttcaccgttgttggtcgaggaaagttcacctccgtgtcttctctagtgtgataactcagggtt 49280315  T
108 gagtgagacatggcagaaatcttaaagtgctgtgcgaggaaagaagagttagggctttcgtgacct 173  Q
    ||| |||||||||||||||||| |||||||| |  |||| || ||||||||||||||||| |||||    
49280316 gagagagacatggcagaaatctgaaagtgctatatgagggaa-aagagttagggctttcgagacct 49280380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 337 - 457
Target Start/End: Original strand, 2597808 - 2597927
Alignment:
337 gaggaacattagatatagctctctcataaacctccctagttttttccttatcccctacactttcttccaatcgtatatattcaaaccaggaatcatagtt 436  Q
    |||||||||||| |||||||||||||||||||||| ||||| ||||||||| ||| ||||| |||| | ||| |||||| ||||||||  ||||||| ||    
2597808 gaggaacattagctatagctctctcataaacctccatagttctttccttattcccgacactctctttccatcttatataatcaaacca-taatcataatt 2597906  T
437 gaaaggattttccctcacttc 457  Q
     ||  |||||| |||||||||    
2597907 caacagatttttcctcacttc 2597927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 70; Significance: 3e-31; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 336 - 457
Target Start/End: Original strand, 2292655 - 2292776
Alignment:
336 ggaggaacattagatatagctctctcataaacctccctagttttttccttatcccctacactttcttccaatcgtatatattcaaaccaggaatcatagt 435  Q
    ||||||||||| | |||||||||||||||||||||||||||| ||||||||| ||| ||||| |||||||||| |||||| |||||||| |||||||| |    
2292655 ggaggaacattggctatagctctctcataaacctccctagttctttccttattcccaacactctcttccaatcttatataatcaaaccatgaatcataat 2292754  T
436 tgaaaggattttccctcacttc 457  Q
    | || ||||||| |||||||||    
2292755 tcaacggatttttcctcacttc 2292776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 59; Significance: 1e-24; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 337 - 447
Target Start/End: Complemental strand, 34788538 - 34788428
Alignment:
337 gaggaacattagatatagctctctcataaacctccctagttttttccttatcccctacactttcttccaatcgtatatattcaaaccaggaatcatagtt 436  Q
    |||| ||||||| |||||||||||||||||||||||||||| ||||||||| ||| ||||| |||||||||| |||||| ||||||||  ||||||| ||    
34788538 gaggtacattagctatagctctctcataaacctccctagttctttccttattcccgacactctcttccaatcttatataatcaaaccacaaatcataatt 34788439  T
437 gaaaggatttt 447  Q
     || |||||||    
34788438 caatggatttt 34788428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 336 - 387
Target Start/End: Complemental strand, 24602247 - 24602196
Alignment:
336 ggaggaacattagatatagctctctcataaacctccctagttttttccttat 387  Q
    ||||||||||||| || ||||||||||||||||||| | ||| |||||||||    
24602247 ggaggaacattagctacagctctctcataaacctccttggttgtttccttat 24602196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108417 times since January 2019
Visitors: 1329