View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-57 (Length: 503)

Name: J5-7-57
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-57
J5-7-57
[»] chr2 (3 HSPs)
chr2 (1-300)||(31763233-31763532)
chr2 (399-503)||(31763133-31763237)
chr2 (371-406)||(31763603-31763638)


Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 31763233 - 31763532
Alignment:
1 cattttaggtagtatctgtctggaaaagtgttggtttcaaatttgcaatgtttattttaagtagtagcagaatctgataatacatgtttattaggaatat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31763233 cattttaggtagtatctgtctggaaaagtgttggtttcaaatttgcaatgtttattttaagtagtagcagaatctgataatacatgtttattaggaatat 31763332  T
101 gtgaaggattttggtatttgaagtatggacatttttgtaattttaaaggacagagaatctcaagttgtataattttgacnnnnnnnatagaaaataataa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||    
31763333 gtgaaggattttggtatttgaagtatggacatttttgtaattttaaaggacagagaatctcaagttgtataattttgactttttttatagaaaataataa 31763432  T
201 agagccatgtgaacttctgacataatggatgttgaaatgacataaaccttgggaagatgttatatgattcagtcacttacatataacaaaatattcccac 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31763433 agagccatgtgaacttctgacataatggatgttgaaatgacataaaccttgggaagatgttatatgattcagtcacttacatataacaaaatattcccac 31763532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 399 - 503
Target Start/End: Original strand, 31763133 - 31763237
Alignment:
399 attaatatttttaaatgcttatgtaactgtttttaaaataaattnnnnnnncagaagtagctcaaacatgttgtaanaactaaaactattattattacta 498  Q
    ||||||||||||||||||||||||||||||||||||||||||||       || |||||||||||||||||||||| |||||||||||||||||||||||    
31763133 attaatatttttaaatgcttatgtaactgtttttaaaataaattaaaaaaacaaaagtagctcaaacatgttgtaataactaaaactattattattacta 31763232  T
499 cattt 503  Q
    |||||    
31763233 cattt 31763237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 371 - 406
Target Start/End: Original strand, 31763603 - 31763638
Alignment:
371 agtgagagatccgttacaactaatctgcattaatat 406  Q
    ||||||||||||||||||||||||||||||||||||    
31763603 agtgagagatccgttacaactaatctgcattaatat 31763638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360526 times since January 2019
Visitors: 484