View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-60 (Length: 127)

Name: J5-7-60
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-60
J5-7-60
[»] chr4 (1 HSPs)
chr4 (15-127)||(19633209-19633320)


Alignment Details
Target: chr4 (Bit Score: 93; Significance: 1e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 15 - 127
Target Start/End: Complemental strand, 19633320 - 19633209
Alignment:
15 ttaatattgttatatcaagtgcgaataatacctttccataacgatagataaaggtataatgatatttagtgatgctaggtatccttgaagaattgcgaat 114  Q
    |||||||||||||||||  ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
19633320 ttaatattgttatatcatttgcgaataatacctttccataacaatagataaag-tataatgatatttagtgatgctaggtatccttgaagaattgcgaat 19633222  T
115 aatttatctaata 127  Q
    |||||||||||||    
19633221 aatttatctaata 19633209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 203483 times since January 2019
Visitors: 1517