View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-61 (Length: 336)

Name: J5-7-61
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-61
J5-7-61
[»] chr5 (2 HSPs)
chr5 (1-227)||(40997474-40997700)
chr5 (221-336)||(40997696-40997811)
[»] chr1 (2 HSPs)
chr1 (250-311)||(21898489-21898550)
chr1 (231-305)||(17664892-17664966)


Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 40997700 - 40997474
Alignment:
1 tacctgtcattgtttaatcagtattttgcctttttaacatatgtttctgttaaatgatgatgttgttttgctttatcatgagtggaaaacacgcattttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40997700 tacctgtcattgtttaatcagtattttgcctttttaacatatgtttctgttaaatgatgatgttgttttgctttatcatgagtggaaaacacgcattttc 40997601  T
101 accattgagcagaatttagattatagtacagttctctcagccctgctcacattcaaatccaaagaagccacacctttgtctttagaacataatacaatta 200  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40997600 accattgagcagaatttagattatagtacagttctctcaaccctgctcacattcaaatccaaagaagccacacctttgtctttagaacataatacaatta 40997501  T
201 tcgatatgcatgaaaagtacaattaat 227  Q
    |||||||||||||||||||||||||||    
40997500 tcgatatgcatgaaaagtacaattaat 40997474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 221 - 336
Target Start/End: Complemental strand, 40997811 - 40997696
Alignment:
221 aattaatgtaactgaccttggagccaaattattgtgactagaccttaatgcattgttgaaattcatcctctcaattaagaatgctactatttatttgtta 320  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40997811 aattaatgtaactgaccttggagccaaattattgtgactagaccttaatgcattgttgaaattcatcctctcaattaagaatgctactatttatttgtta 40997712  T
321 ctataattttttacct 336  Q
    ||||||||||||||||    
40997711 ctataattttttacct 40997696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 250 - 311
Target Start/End: Complemental strand, 21898550 - 21898489
Alignment:
250 tattgtgactagaccttaatgcattgttgaaattcatcctctcaattaagaatgctactatt 311  Q
    |||||||||| || |||||||||||||||||||||||| ||||||||| |||||||||||||    
21898550 tattgtgactcgatcttaatgcattgttgaaattcatcgtctcaattatgaatgctactatt 21898489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 231 - 305
Target Start/End: Original strand, 17664892 - 17664966
Alignment:
231 actgaccttggagccaaattattgtgactagaccttaatgcattgttgaaattcatcctctcaattaagaatgct 305  Q
    |||||| ||||| | |||||||||||||  ||  ||||| ||||||||||||| ||||||||||||| |||||||    
17664892 actgactttggaacaaaattattgtgaccggattttaatacattgttgaaatttatcctctcaattatgaatgct 17664966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361940 times since January 2019
Visitors: 488