View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-63 (Length: 573)

Name: J5-7-63
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-63
J5-7-63
[»] chr5 (3 HSPs)
chr5 (78-573)||(43377532-43378028)
chr5 (1-85)||(43377452-43377536)
chr5 (496-551)||(43376893-43376948)


Alignment Details
Target: chr5 (Bit Score: 482; Significance: 0; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 482; E-Value: 0
Query Start/End: Original strand, 78 - 573
Target Start/End: Complemental strand, 43378028 - 43377532
Alignment:
78 ttattaatgttatatcactcattttcttaattaagtaacaaattaagatagtatatatcactcattttcttaattaacaaattaagataggtatcttcca 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43378028 ttattaatgttatatcactcattttcttaattaagtaacaaattaagatagtatatatcactcattttcttaattaacaaattaagataggtatcttcca 43377929  T
178 aatagattagaaagaaaactataactttaaataaagaccccaacaatttttctccccaattaagagaaagagtatttcagtaaatgtaggatcgcatgta 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43377928 aatagattagaaagaaaactataactttaaataaagaccccaacaatttttctccccaattaagagaaagagtatttcagtaaatgtaggatcgcatgta 43377829  T
278 ttctggaaaccttacatgaatcacttgaactcaacttcatgtaaagaagggctaatataagatactaccatacattgaatgacatggcttcattaaatta 377  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
43377828 ttctggaaaccttacatgaatcacttgaactcaacttcatgtaaagaaaggctaatataagatactaccatacattgaatgacatggcttcattaaatta 43377729  T
378 tgagatgctttatcattggccaaaagtcaaaaccaagactgggaccatttctcgttttttcagcatggggacggaagaagtgtcgtttatacaataatag 477  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43377728 tgagatgctttatcattggccaaaagtcaaaaccaagactgggaccatttctcgttttttcagcatggggacggaagaagtgtcgtttatacaataatag 43377629  T
478 caacattgttttcctcgatgtctgattaaaagggattaaacatacaccagntcaactttatagtttatactaagtagtc-aatgccagattaacatt 573  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||    
43377628 caacattgttttcctcgatgtctgattaaaagggattaaacatacaccagttcaactttatagtttatactaagtagtcaaatgccagattaacatt 43377532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 43377536 - 43377452
Alignment:
1 acattcacataaatttcctactgattcacagaattggtttcattttcaaaaagttaaattcaatttatattcgccccttattaat 85  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43377536 acattcacataaatttcctactgattcacagaattggtttcattttcaaaaagttaaattcaatttatattcgccccttattaat 43377452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 496 - 551
Target Start/End: Complemental strand, 43376948 - 43376893
Alignment:
496 tgtctgattaaaagggattaaacatacaccagntcaactttatagtttatactaag 551  Q
    ||||||||||||||||||||||||  ||| || | ||||||||||| |||||||||    
43376948 tgtctgattaaaagggattaaacaggcactagttaaactttatagtgtatactaag 43376893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108129 times since January 2019
Visitors: 1329