View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-7 (Length: 262)

Name: J5-7-7
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-7
J5-7-7
[»] chr7 (2 HSPs)
chr7 (40-262)||(7753798-7754019)
chr7 (1-48)||(7754015-7754062)


Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 40 - 262
Target Start/End: Original strand, 7753798 - 7754019
Alignment:
40 aattaatcaaaccttgaacacaactccactctcaagattaaaaatcttaaaatgattatgccggttattccaatttcaaatgcttataatctttcgtggt 139  Q
    |||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7753798 aattaatcaaaccttgaacacaactt-actctcaagattaaaaatcttaaaatgattatgccggttattccaatttcaaatgcttataatctttcgtggt 7753896  T
140 atagcaagtgtgtgttagaaaatgttcacttctaaagattgtgcgacagttcaaaggtatgtcgtcgtatanttttttgnggttttatgacctcaatctc 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||  ||||||||||| ||||||||    
7753897 atagcaagtgtgtgttagaaaatgttcacttctaaagattgtgcgacagttcaaaggtatgtcgtcgtatagttttttaaggttttatgacttcaatctc 7753996  T
240 atttgaaaaacacacgatggaac 262  Q
    |||||||||||||||||||||||    
7753997 atttgaaaaacacacgatggaac 7754019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 7754015 - 7754062
Alignment:
1 ggaacaacaaattttgacattanaaggtaatgaggagataattaatca 48  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||    
7754015 ggaacaacaaattttgacattaaaaggtaatgaggagataattaatca 7754062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361188 times since January 2019
Visitors: 487