View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-74 (Length: 168)

Name: J5-7-74
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-74
J5-7-74
[»] chr7 (2 HSPs)
chr7 (1-123)||(31446391-31446513)
chr7 (118-168)||(31446509-31446559)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 31446513 - 31446391
Alignment:
1 tataggatactctctatatgttttttatggttttgtaaaatgttctgtatggtgttgtaaattgattgaaaattcattaaagaaatgttgagtattggtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31446513 tataggatactctctatatgttttttatggttttgtaaaatgttctgtatggtgttgtaaattgattgaaaattcattaaagaaatgttgagtattggtt 31446414  T
101 tgataactacaacttacattaat 123  Q
    |||||||||||||||||||||||    
31446413 tgataactacaacttacattaat 31446391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 118 - 168
Target Start/End: Complemental strand, 31446559 - 31446509
Alignment:
118 attaatggagtgtacaaacatatgaaatatatataatgtgcatccttatag 168  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
31446559 attaatggagtgtacaaacatatgaaatatatataatgtgcatccttatag 31446509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 202701 times since January 2019
Visitors: 1517