View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-7-74 (Length: 168)
Name: J5-7-74
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5-7-74 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 31446513 - 31446391
Alignment:
Q |
1 |
tataggatactctctatatgttttttatggttttgtaaaatgttctgtatggtgttgtaaattgattgaaaattcattaaagaaatgttgagtattggtt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31446513 |
tataggatactctctatatgttttttatggttttgtaaaatgttctgtatggtgttgtaaattgattgaaaattcattaaagaaatgttgagtattggtt |
31446414 |
T |
 |
Q |
101 |
tgataactacaacttacattaat |
123 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
31446413 |
tgataactacaacttacattaat |
31446391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 118 - 168
Target Start/End: Complemental strand, 31446559 - 31446509
Alignment:
Q |
118 |
attaatggagtgtacaaacatatgaaatatatataatgtgcatccttatag |
168 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31446559 |
attaatggagtgtacaaacatatgaaatatatataatgtgcatccttatag |
31446509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 202701 times since January 2019
Visitors: 1517