View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-7-9 (Length: 144)
Name: J5-7-9
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5-7-9 |
 |  |
|
[»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 2e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 23 - 144
Target Start/End: Complemental strand, 2115816 - 2115695
Alignment:
Q |
23 |
attaatcatatattatactatagttctagatcacatatttccttatgaaatgtaatcatgaananaaacaaataccatatattttgttatatgatcatca |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
T |
2115816 |
attaatcatatattatactatagttctagatcacatatttccttatgaaatgtaatcatgaagataaacaaataccatatattttgttatatgatcatca |
2115717 |
T |
 |
Q |
123 |
atgattcaatccatcaaataag |
144 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
2115716 |
atgattcaatccatcaaataag |
2115695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 1 - 28
Target Start/End: Complemental strand, 2115699 - 2115672
Alignment:
Q |
1 |
ataaggggggaaatcataagaaattaat |
28 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
2115699 |
ataaggggggaaatcataagaaattaat |
2115672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 105928 times since January 2019
Visitors: 1319