View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-9 (Length: 144)

Name: J5-7-9
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-9
J5-7-9
[»] chr2 (2 HSPs)
chr2 (23-144)||(2115695-2115816)
chr2 (1-28)||(2115672-2115699)


Alignment Details
Target: chr2 (Bit Score: 116; Significance: 2e-59; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 23 - 144
Target Start/End: Complemental strand, 2115816 - 2115695
Alignment:
23 attaatcatatattatactatagttctagatcacatatttccttatgaaatgtaatcatgaananaaacaaataccatatattttgttatatgatcatca 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||    
2115816 attaatcatatattatactatagttctagatcacatatttccttatgaaatgtaatcatgaagataaacaaataccatatattttgttatatgatcatca 2115717  T
123 atgattcaatccatcaaataag 144  Q
    ||||||||||||||||||||||    
2115716 atgattcaatccatcaaataag 2115695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 1 - 28
Target Start/End: Complemental strand, 2115699 - 2115672
Alignment:
1 ataaggggggaaatcataagaaattaat 28  Q
    ||||||||||||||||||||||||||||    
2115699 ataaggggggaaatcataagaaattaat 2115672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105928 times since January 2019
Visitors: 1319