View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-92 (Length: 218)

Name: J5-7-92
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-92
J5-7-92
[»] chr8 (2 HSPs)
chr8 (1-195)||(15201079-15201273)
chr8 (82-129)||(16034857-16034904)
[»] chr6 (1 HSPs)
chr6 (82-129)||(31431272-31431319)


Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 15201273 - 15201079
Alignment:
1 tcttcctcttttcacctttcataacttgntttcctggnggctgaatgatatgtttcaatattcttcttgccgttgctacnattccngtcttagaatggtt 100  Q
    |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||    
15201273 tcttcctcttttcacctttcataacttgttttcctggtggctgaatgatatgtttcaatattcttcttgccgttgctacaattccagtcttagaatggtt 15201174  T
101 tagatcaataagaatctcttcattaaaaatctgatcttggtccatcctnnnnnnncanaaggnctggcccaaaatgacaacntcgactccaaaac 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||       || |||| ||||| |||||||||||| || |||| |||||    
15201173 tagatcaataagaatctcttcattaaaaatctgatcttggtccatcctaaaaaaacaaaaggtctggcacaaaatgacaacatcaactcaaaaac 15201079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 129
Target Start/End: Original strand, 16034857 - 16034904
Alignment:
82 ttccngtcttagaatggtttagatcaataagaatctcttcattaaaaa 129  Q
    |||| ||||||||||| |||||||||||| ||||||| ||||| ||||    
16034857 ttccagtcttagaatgctttagatcaatatgaatctcatcattgaaaa 16034904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 129
Target Start/End: Complemental strand, 31431319 - 31431272
Alignment:
82 ttccngtcttagaatggtttagatcaataagaatctcttcattaaaaa 129  Q
    |||| ||||||||||| |||||||||||| ||||||| ||||| ||||    
31431319 ttccagtcttagaatgctttagatcaatatgaatctcatcattgaaaa 31431272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361827 times since January 2019
Visitors: 488