View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-96 (Length: 647)

Name: J5-7-96
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-96
J5-7-96
[»] chr2 (2 HSPs)
chr2 (1-453)||(42762889-42763341)
chr2 (443-647)||(42763337-42763540)
[»] scaffold0021 (2 HSPs)
scaffold0021 (27-385)||(114744-115082)
scaffold0021 (439-540)||(115129-115230)


Alignment Details
Target: chr2 (Bit Score: 408; Significance: 0; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 408; E-Value: 0
Query Start/End: Original strand, 1 - 453
Target Start/End: Complemental strand, 42763341 - 42762889
Alignment:
1 gtcagttcaaagatagaccnnnnnnntattaacaaaatccatcatgaaagaatacatgaaagaagcaaaatcaaccattttctcnatgctgtatcgcaag 100  Q
    |||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
42763341 gtcagttcaaagatagaccaaaaaaatattaacaaaatccatcatgaaagaatacatgaaagaagcaaaatcaaccattttctcaatgctgtatcgcaag 42763242  T
101 gcagtaatcacgtcattcttagtcacctataaaacgtaaatagcactcaattaaagacggcaatgccaagaagcacaaaaattgtgtacaaaaacataat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42763241 gcagtaatcacgtcattcttagtcacctataaaacgtaaatagcactcaattaaagacggcaatgccaagaagcacaaaaattgtgtacaaaaacataat 42763142  T
201 taacttcatatatatctctataatctaacctttctatcccgatcatcaacaactccacgtgctatttctctcatcatcactaaagaatgaacttgctggt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42763141 taacttcatatatatctctataatctaacctttctatcccgatcatcaacaactccacgtgctatttctctcatcatcactaaagaatgaacttgctggt 42763042  T
301 tatctaaattcaccgaagacattgaattgattccttccaaaatcttatgacacccactcttaattatctctttgtgatgctccatnnnnnnnctggcaaa 400  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||    
42763041 tatctaaattcaccgaagacattgaattgattccttccaaaatcttatgacacccactcttaattatctctttgtgatgctccataaaaaaactggcaaa 42762942  T
401 tgtgacaaaccaaaataacccagatgaaaattttcactcaaagcagcattaat 453  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
42762941 tgtgacaaaccaaaataacccagatgaaaattttcactcaaagcagcattaat 42762889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 443 - 647
Target Start/End: Complemental strand, 42763540 - 42763337
Alignment:
443 gcagcattaatcccttacttggtcggcaagtaactcaggcctagctattgcanctctaggttgctcatcaacaatcccacgagcaatttctttcatcccc 542  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |    
42763540 gcagtattaatcccttacttggtcggcaagtaactcaggcctagctattgcaactctaggttgctcatcaacaatcccatgagcaatttctttcatcctc 42763441  T
543 aatactaaatgcatcctctggtcatccaagccttccataggacatcctacttaacatatgaacgatatctctggnngcacccacctgcaaactgccccag 642  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||  |||| ||||||||||||||| ||     
42763440 aatactaaatgcatcctctggtcatccaagcctt-cataggacatcctacttaacatatgaacgatatctctggatgcacacacctgcaaactgcctcaa 42763342  T
643 gtcag 647  Q
    |||||    
42763341 gtcag 42763337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 177; Significance: 4e-95; HSPs: 2)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 177; E-Value: 4e-95
Query Start/End: Original strand, 27 - 385
Target Start/End: Complemental strand, 115082 - 114744
Alignment:
27 tattaacaaaatccatcatgaaagaatacatgaaagaagcaaaatcaaccattttctcnatgctgtatcgcaaggcagtaatcacgtcattcttagtcac 126  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||             |||||||||||||||||||||||||||||    
115082 tattaacaaaatccatcatgaatgaatacatgaaagaagcaaaatcaaccattttctc-------------aaggcagtaatcacgtcattcttagtcac 114996  T
127 ctataaaacgtaaatagcactcaattaaagacggcaatgccaagaagcacaaaaattgtgtacaaaaacataattaacttcatatatatctctataatct 226  Q
    ||||| || ||||  |||||||   ||| |||||       || | |||| | |||||||||||||||||||||||||||| ||||||||||||||||||    
114995 ctatagaatgtaagcagcactcttctaatgacgg-------aataggcacgagaattgtgtacaaaaacataattaacttcttatatatctctataatct 114903  T
227 aacctttctatcccgatcatcaacaactccacgtgctatttctctcatcatcactaaagaatgaacttgctggttatctaaattcaccgaagacattgaa 326  Q
    |||||||||||| ||| ||  |||||||||||| ||||||||||||||| ||| ||| || ||||||||||||| ||||||||||||| |||||||||||    
114902 aacctttctatctcgaccaaaaacaactccacgcgctatttctctcatcgtcattaaggagtgaacttgctggtcatctaaattcaccaaagacattgaa 114803  T
327 ttgattccttccaaaatcttatgacacccactcttaattatctctttgtgatgctccat 385  Q
    |||||||||||||||||||||| | || |||||||||||||||||||||||||||||||    
114802 ttgattccttccaaaatcttataatactcactcttaattatctctttgtgatgctccat 114744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 439 - 540
Target Start/End: Complemental strand, 115230 - 115129
Alignment:
439 caaagcagcattaatcccttacttggtcggcaagtaactcaggcctagctattgcanctctaggttgctcatcaacaatcccacgagcaatttctttcat 538  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||  |||||||||||| ||||||||||||||||    
115230 caaagcagtattaatcccttacttggtcggcaagtaactcaggcctagctgttgcaactctaggttgcttctcaacaatcccatgagcaatttctttcat 115131  T
539 cc 540  Q
    ||    
115130 cc 115129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361505 times since January 2019
Visitors: 488