View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-9_18 (Length: 125)

Name: J5-9_18
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-9_18
J5-9_18
[»] chr2 (1 HSPs)
chr2 (1-125)||(57264-57388)


Alignment Details
Target: chr2 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 57388 - 57264
Alignment:
1 ttaattattaaacatagttaggcaagaatgaaatgaattgatcttattctcatctaggtgggaatgtggtgcgtacacgtgtnccnaataagtgcggggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    ||||||||||||||    
57388 ttaattattaaacatagttaggcaagaatgaaatgaattgatcttattctcatcttggtgggaatgtggtgcgtacacgtgtaaagaataagtgcggggg 57289  T
101 gcgtaggtggagtctcataattaat 125  Q
    |||||||||||||||||||||||||    
57288 gcgtaggtggagtctcataattaat 57264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 315021 times since January 2019
Visitors: 446