View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-9_18 (Length: 125)
Name: J5-9_18
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5-9_18 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 57388 - 57264
Alignment:
Q |
1 |
ttaattattaaacatagttaggcaagaatgaaatgaattgatcttattctcatctaggtgggaatgtggtgcgtacacgtgtnccnaataagtgcggggg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
57388 |
ttaattattaaacatagttaggcaagaatgaaatgaattgatcttattctcatcttggtgggaatgtggtgcgtacacgtgtaaagaataagtgcggggg |
57289 |
T |
 |
Q |
101 |
gcgtaggtggagtctcataattaat |
125 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
57288 |
gcgtaggtggagtctcataattaat |
57264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 315021 times since January 2019
Visitors: 446