View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-9_20 (Length: 296)

Name: J5-9_20
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-9_20
J5-9_20
[»] chr2 (2 HSPs)
chr2 (92-296)||(4343429-4343633)
chr2 (1-99)||(4343629-4343727)
[»] chr8 (1 HSPs)
chr8 (225-261)||(12140641-12140677)


Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 92 - 296
Target Start/End: Original strand, 4343429 - 4343633
Alignment:
92 aattaatgtgtccattattaggttgaagttcttctaaccctaatatgatgtgtaaatgtttctcaacttctattgcgaccctcactctaaaaatgattaa 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
4343429 aattaatgtgtccattattaggttgaagttcttctaaccctaatatgatgtgtaaatgtttctcaacttctattgcgaccttcactctaaaaatgattaa 4343528  T
192 gggtttatacaaggttttnnnnnnntgcctgcgacatcaaagtttttgatgtctctgcgaccacgattgaggctcaatcagctttcttcaactgngaata 291  Q
    ||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
4343529 gggtttatacaaggttttaaaaaaatgcctgcgacatcaaagtttttgatgtctctgcgaccacgattgaggctcaatcagctttcttcaactgcgaata 4343628  T
292 ttaag 296  Q
    |||||    
4343629 ttaag 4343633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 4343629 - 4343727
Alignment:
1 ttaaggacaacaacgtggccactactatgatttaaaactttggctgcatgtgcacgtaatttncntctgagttggactaaaattttaatccaattaatg 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||    
4343629 ttaaggacaacaacgtggccactactatgatttaaaactttggctgcatgtgcacgtaatttaaatctgagttggactaaaattttaatccaattaatg 4343727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 225 - 261
Target Start/End: Complemental strand, 12140677 - 12140641
Alignment:
225 acatcaaagtttttgatgtctctgcgaccacgattga 261  Q
    ||||||| ||||||||||||||||||| |||||||||    
12140677 acatcaaggtttttgatgtctctgcgatcacgattga 12140641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201429 times since January 2019
Visitors: 1513