View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-9_21 (Length: 251)

Name: J5-9_21
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-9_21
J5-9_21
[»] chr2 (1 HSPs)
chr2 (1-230)||(34011367-34011596)


Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 34011596 - 34011367
Alignment:
1 gttaaaagcaanctatgattggttgtaaatttgtaataaaccaatgacctgctataccttatcttagatatctctaacaaatcngtgtttagtgagttca 100  Q
    ||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
34011596 gttaaaagcatgctatgattggttgtaaatttgtaataaaccaatgacctgctataccttatcttagatatctctaacaaatcagtgtttagtgagttca 34011497  T
101 gtttgaaataattaggctcggtaaagaacaccttaacttaggaaaatttattcgcaagtaccttagtgcggcnnaatgacaactaaattaaatgagcatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||    
34011496 gtttgaaataattaggctcggtaaagaacaccttaacttaggaaaatttattcgcaagtaccttagtgcggctcaatgacaactaaattaaatgagcatg 34011397  T
201 gtttatactcccttcgtcttaagattaatt 230  Q
    ||||||||||||||||||||||||||||||    
34011396 gtttatactcccttcgtcttaagattaatt 34011367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110623 times since January 2019
Visitors: 1335