View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-9_21 (Length: 251)
Name: J5-9_21
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5-9_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 34011596 - 34011367
Alignment:
Q |
1 |
gttaaaagcaanctatgattggttgtaaatttgtaataaaccaatgacctgctataccttatcttagatatctctaacaaatcngtgtttagtgagttca |
100 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
34011596 |
gttaaaagcatgctatgattggttgtaaatttgtaataaaccaatgacctgctataccttatcttagatatctctaacaaatcagtgtttagtgagttca |
34011497 |
T |
 |
Q |
101 |
gtttgaaataattaggctcggtaaagaacaccttaacttaggaaaatttattcgcaagtaccttagtgcggcnnaatgacaactaaattaaatgagcatg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
34011496 |
gtttgaaataattaggctcggtaaagaacaccttaacttaggaaaatttattcgcaagtaccttagtgcggctcaatgacaactaaattaaatgagcatg |
34011397 |
T |
 |
Q |
201 |
gtttatactcccttcgtcttaagattaatt |
230 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
34011396 |
gtttatactcccttcgtcttaagattaatt |
34011367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 110623 times since January 2019
Visitors: 1335