View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-9_25 (Length: 362)

Name: J5-9_25
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-9_25
J5-9_25
[»] chr4 (1 HSPs)
chr4 (15-362)||(46937997-46938343)


Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 15 - 362
Target Start/End: Complemental strand, 46938343 - 46937997
Alignment:
15 taataatcttactgcctcaaaccatgtgcacaacatcagaaacaaggtttatttacttatttatgtacgnnccttgcttactggtcagcaaaatttataa 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||    
46938343 taataatcttactgcctcaaaccatgtgcacaacatcagaaacaaggtttatttacttatttatgtacgtat-ttgcttactggtcagcaaaatttataa 46938245  T
115 tatactatgttttctatttannnnnnnnatttaacnnnnnnntaacaacattgttttgataaatttatttatttacaatatatttccggtgtgttcatgt 214  Q
    ||||||||||||||||||||        |||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46938244 tatactatgttttctatttattttttttatttaacaaaaaaataacaacattgttttgataaatttatttatttacaatatatttccggtgtgttcatgt 46938145  T
215 gcaggagtttgacaaagcctatggtcctgcctggcattgcattgtaggcccaagttttggttcttttgtgacacatccaacggggtgttttctttacttt 314  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
46938144 gcaggagtttgacaaagcctatggtcctgcctggcattgcattgtaggcccaagttttggttcttttgtgacacattcaacggggtgttttctttacttt 46938045  T
315 tcaatggaaaatttatatattctattgttcaggaccaaagttaagaag 362  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||    
46938044 tcaatggaaaatttatatattctattgttcaagaccaaagttaagaag 46937997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 307182 times since January 2019
Visitors: 441