View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-9_65 (Length: 340)

Name: J5-9_65
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-9_65
J5-9_65
[»] chr4 (2 HSPs)
chr4 (1-139)||(46937863-46938001)
chr4 (214-254)||(46937748-46937788)


Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 46938001 - 46937863
Alignment:
1 agaaggcagtggattaattaaggtgcatattattatatttatacatatataagatttagcaacagctctttatgttgctggcaaagtttgtgtccaaagg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46938001 agaaggcagtggattaattaaggtgcatattattatatttatacatatataagatttagcaacagctctttatgttgctggcaaagtttgtgtccaaagg 46937902  T
101 acttgtcttgtctgtacatgaaaattaaaatgtaatcaa 139  Q
    |||||||||||||||||||||||||||||||||||||||    
46937901 acttgtcttgtctgtacatgaaaattaaaatgtaatcaa 46937863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 214 - 254
Target Start/End: Complemental strand, 46937788 - 46937748
Alignment:
214 ataaacatcacaaattggcaaataaatcagcacttcaatta 254  Q
    |||||||||||||||||||||||||||||||||||||||||    
46937788 ataaacatcacaaattggcaaataaatcagcacttcaatta 46937748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106190 times since January 2019
Visitors: 1320