View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-9_65 (Length: 340)
Name: J5-9_65
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5-9_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 46938001 - 46937863
Alignment:
Q |
1 |
agaaggcagtggattaattaaggtgcatattattatatttatacatatataagatttagcaacagctctttatgttgctggcaaagtttgtgtccaaagg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46938001 |
agaaggcagtggattaattaaggtgcatattattatatttatacatatataagatttagcaacagctctttatgttgctggcaaagtttgtgtccaaagg |
46937902 |
T |
 |
Q |
101 |
acttgtcttgtctgtacatgaaaattaaaatgtaatcaa |
139 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46937901 |
acttgtcttgtctgtacatgaaaattaaaatgtaatcaa |
46937863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 214 - 254
Target Start/End: Complemental strand, 46937788 - 46937748
Alignment:
Q |
214 |
ataaacatcacaaattggcaaataaatcagcacttcaatta |
254 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46937788 |
ataaacatcacaaattggcaaataaatcagcacttcaatta |
46937748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 106190 times since January 2019
Visitors: 1320