View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-9_77 (Length: 643)

Name: J5-9_77
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-9_77
J5-9_77
[»] chr4 (7 HSPs)
chr4 (1-642)||(44865624-44866266)
chr4 (3-529)||(44900318-44900853)
chr4 (2-371)||(44851564-44851940)
chr4 (1-347)||(44883785-44884140)
chr4 (201-445)||(44840003-44840247)
chr4 (3-146)||(44840314-44840457)
chr4 (441-485)||(44851499-44851543)
[»] chr3 (2 HSPs)
chr3 (227-342)||(12924838-12924953)
chr3 (65-113)||(12924677-12924725)


Alignment Details
Target: chr4 (Bit Score: 566; Significance: 0; HSPs: 7)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 566; E-Value: 0
Query Start/End: Original strand, 1 - 642
Target Start/End: Complemental strand, 44866266 - 44865624
Alignment:
1 attactggtcagaatgattgcacgatcctgtttcgcaagcttgataacattccataggcatttccttgaagcagggtctaatccagtacttggttcatcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44866266 attactggtcagaatgattgcacgatcctgtttcgcaagcttgataacattccataggcatttccttgaagcagggtctaatccagtacttggttcatcc 44866167  T
101 atataaacaacctaaatttgaattgtcatttacaaaatacgaaaacatgaatctccnnnnnnnattaaaagaaatgaaaaagatcaaatagggttgaaac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||    
44866166 atataaacaacctaaatttgaattgtcatttacaaaatacgaaaacatgaatctcctttttttattaaaagaaatgaaaaagatcaaatagggttgaaac 44866067  T
201 aaaaacaaactttggggtccccaatcaatgaaattgcaacactaagcctcctcttcatccctccactgtattttccagcttttttatcagcaacccctcc 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44866066 aaaaacaaactttggggtccccaatcaatgaaattgcaacactaagcctcctcttcatccctccactgtattttccagcttttttatcagcaacccctcc 44865967  T
301 atggaaaaggtttaaattcttcaaagattcttctactgcctgtaacagtagaatgcaagctaaatagttacgattttacctttcaaacaaatggcagcta 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44865966 atggaaaaggtttaaattcttcaaagattcttctactgcctgtaacagtagaatgcaagctaaatagttacgattttacctttcaaacaaatggcagcta 44865867  T
401 aagaggaagttgttcaaaatacatcttaactgcaattatcttttacagatccgtactcttcacagaataataagcaataaaaattgcaggag-aacatgt 499  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
44865866 aagaggaagttgttcaaaatacatcttaactgcaattatcttttacagatccgtactcttcacagaataataagcaataaaaattgcaggagaaacatgt 44865767  T
500 tactaaaggacctaaaatgtgttttgtcttcnccacannnnnnnaaatactttattctgaatcncgctgagatgattcatagggtaatcataaaaanccc 599  Q
    ||||||||||||||||||||||||||||||| |||||       ||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||    
44865766 tactaaaggacctaaaatgtgttttgtcttctccacatttttttaaatactttattctgaatcacgctgagatgattcata-ggtaatcataaaaaaccc 44865668  T
600 gttccttta-tggnttattataaaattacagggtccttgaacaa 642  Q
    ||||||||| ||| ||||||||||||||||||||||||||||||    
44865667 gttcctttattggtttattataaaattacagggtccttgaacaa 44865624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 3 - 529
Target Start/End: Complemental strand, 44900853 - 44900318
Alignment:
3 tactggtcagaatgattgcacgatcctgtttcgcaagcttgataacattccataggcatttccttgaagcagggtctaatccagtacttggttcatccat 102  Q
    ||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||    
44900853 tactggttagaatgattgcacgatcctgtttcgcaagcctgataacattccataggcatttccttgaagcagggtctaatcccgtgcttggctcatccat 44900754  T
103 ataaacaacctaaatttgaattgtcatttacaaaatacgaaaacatgaatctccnnnnnnnattaaaagaaatgaaaaaga--------tcaaatagggt 194  Q
    ||||||||||||||||||||||| ||| |||| |||| |||||| |||||||         ||||||| ||||||||||||        ||||||  |||    
44900753 ataaacaacctaaatttgaattggcatgtacagaataagaaaacttgaatctt-attttttattaaaa-aaatgaaaaagaaaaaaaaatcaaatttggt 44900656  T
195 tgaaacaaaaaca--aactttggggtccccaatcaatgaaattgcaacactaagcctcctcttcatccctccactgtattttccagcttttttatcagca 292  Q
    ||||| ||||| |  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||  |||||||||    
44900655 tgaaataaaaaaactaactttggggtccccaatcaatgaaattgcaacactaagcctcctcttcatccctccactgtattttcctgcttgcttatcagca 44900556  T
293 acccctccatggaaaaggtttaaattcttcaaagattcttctactgcctgtaacagtagaatgcaagctaaatagttacgattttacctttcaaacaaat 392  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||| ||||||||||||||| ||||| |||||||| |||||    
44900555 acacctccatggaaaaggtttaaattcttcaaagattcttctactgcctgcaacaataaaatggaagctaaatagttacaattttccctttcaagcaaat 44900456  T
393 ggcagctaaagaggaagttgttcaaaatacatcttaactgcaattatcttttacagatccgtactcttc---acagaataataagcaataaaaattgcag 489  Q
    | || | ||||||||||||||| ||| | ||||| ||||||||| |||||||| ||||||  |||||||   |||||| |||| |||||||||||||  |    
44900455 gccatcaaaagaggaagttgtttaaattgcatctaaactgcaatcatcttttatagatccagactcttctcaacagaaaaatatgcaataaaaattg--g 44900358  T
490 gagaacatgttactaaaggacctaaaatgtgttttgtctt 529  Q
    |  || ||||||  |||| |||||||||||||||||||||    
44900357 ggaaatatgttatgaaagcacctaaaatgtgttttgtctt 44900318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 2 - 371
Target Start/End: Complemental strand, 44851940 - 44851564
Alignment:
2 ttactggtcagaatgattgcacgatcctgtttcgcaagcttgataacattccataggcatttccttgaagcagggtctaatccagtacttggttcatcca 101  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
44851940 ttactggtcagaataattgcacgatcctgtttcgcaagcttgataacattccataggcatttccttgaagcagggtctaatccagtacttggctcatcca 44851841  T
102 tataaacaacctaaatttgaattgtcatttacaaaatacgaaaacatgaatctccnnnnnnnattaaaagaaatgaaaaaga-------tcaaatagggt 194  Q
    |||||||||||||||||||||||| ||| |||| |||| |||||| |||||||         ||||||| ||||||||||||       ||||||  |||    
44851840 tataaacaacctaaatttgaattggcatgtacagaataagaaaacttgaatctt-attttttattaaaa-aaatgaaaaagaaaaaatgtcaaattcggt 44851743  T
195 tgaaacaaaaa--caaactttggggtccccaatcaatgaaattgcaacactaagcctcctcttcatccctccactgtattttccagcttttttatcagca 292  Q
    ||||| |||||  ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||  || ||||||||||    
44851742 tgaaataaaaaaacaaactttggggtccccaatcaatgaaattgcaacactaagtctcctcttcatccctccactgtattttccacattgtttatcagca 44851643  T
293 acccctccatggaaaaggtttaaattcttcaaagattcttctactgcctgtaacagtagaatgcaagctaaatagttac 371  Q
    |||||||||| ||||||||||||| |||||||||||||||||||||||||||||| || ||||  ||||||||||||||    
44851642 acccctccatagaaaaggtttaaactcttcaaagattcttctactgcctgtaacaatataatggtagctaaatagttac 44851564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 347
Target Start/End: Complemental strand, 44884140 - 44883785
Alignment:
1 attactggtcagaatgattgcacgatcctgtttcgcaagcttgataacattccataggcatttccttgaagcagggtctaatccagtacttggttcatcc 100  Q
    |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||| ||||||||||||||||| |||||||| ||||||    
44884140 attactggtcagaatgattgcacgatcctgtttcgcaagcctgatagcattccataggcaattcctagaagcagggtctaatccggtacttggctcatcc 44884041  T
101 atataaacaacctaaatttgaattgtcatttacaaaatacgaaaacatgaatctccnnnnnnnattaaaagaa--atgaaaaag-------atcaaatag 191  Q
    |||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |       ||||||| ||  |||||||||       ||||||| |    
44884040 atataaacaacctaaatttgaattgtcatttacaaaatacaaaaacttgaatcttcatattt-attaaaaaaagaatgaaaaaggaaaatgatcaaattg 44883942  T
192 ggttgaaa-caaaaacaaactttggggtccccaatcaatgaaattgcaacactaagcctcctcttcatccctccactgtattttccagcttttttatcag 290  Q
     ||||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
44883941 agttgaaaacagaaacaaactttggggtccccaatcaatgaaatggcaacactaagcctcctcttcatccctccactgtattttccagcttgtttatcag 44883842  T
291 caacccctccatggaaaaggtttaaattcttcaaagattcttctactgcctgtaaca 347  Q
    |||||||||||| |||||||||||||  |||||||||||||||||||||||| ||||    
44883841 caacccctccatagaaaaggtttaaaaccttcaaagattcttctactgcctgcaaca 44883785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 201 - 445
Target Start/End: Complemental strand, 44840247 - 44840003
Alignment:
201 aaaaacaaactttggggtccccaatcaatgaaattgcaacactaagcctcctcttcatccctccactgtattttccagcttttttatcagcaacccctcc 300  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||    
44840247 aaaaacaaactctggggtccccaatcaatgaaattgcaacactaagcctcctcttcatccctccactgtattttccagcttgtttatcagcaatccctcc 44840148  T
301 atggaaaaggtttaaattcttcaaagattcttctactgcctgtaacagtagaatgcaagctaaatagttacgattttacctttcaaacaaatggcagcta 400  Q
    |||| ||||||| ||| |||||||||||||||||||||||||||||| || |||| | ||||||||||||  |  || ||| ||||||||| |  |||||    
44840147 atggtaaaggttcaaactcttcaaagattcttctactgcctgtaacaatataatggatgctaaatagttaaaaaattccctgtcaaacaaaggcaagcta 44840048  T
401 aagaggaagttgttcaaaatacatcttaactgcaattatctttta 445  Q
     |||| |||||||||||| | ||||| ||||| ||| ||||||||    
44840047 cagagaaagttgttcaaattgcatctaaactgaaatcatctttta 44840003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 3 - 146
Target Start/End: Complemental strand, 44840457 - 44840314
Alignment:
3 tactggtcagaatgattgcacgatcctgtttcgcaagcttgataacattccataggcatttccttgaagcagggtctaatccagtacttggttcatccat 102  Q
    |||| |||| |||||||||||| ||| ||||||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||     
44840457 tactagtcaaaatgattgcacggtccagtttcgcaatcttgataacattccaaagccatttccttgaagcagggtctaatccagtacttggctcatccaa 44840358  T
103 ataaacaacctaaatttgaattgtcatttacaaaatacgaaaac 146  Q
    |||||||| |||||||||||||| ||||||||||||| ||||||    
44840357 ataaacaatctaaatttgaattggcatttacaaaataagaaaac 44840314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 441 - 485
Target Start/End: Complemental strand, 44851543 - 44851499
Alignment:
441 ttttacagatccgtactcttcacagaataataagcaataaaaatt 485  Q
    ||||| |||||| |||||||||||||| |||||||||||||||||    
44851543 ttttatagatccatactcttcacagaaaaataagcaataaaaatt 44851499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 76; Significance: 8e-35; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 227 - 342
Target Start/End: Original strand, 12924838 - 12924953
Alignment:
227 aatgaaattgcaacactaagcctcctcttcatccctccactgtattttccagcttttttatcagcaacccctccatggaaaaggtttaaattcttcaaag 326  Q
    |||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||| || |||||||||| | | |||||||    
12924838 aatgaaattgcaacactaagcctcctcttcattcctccactatattttccagcctttttatcagcaacccctccgtgaaaaaggtttacacttttcaaag 12924937  T
327 attcttctactgcctg 342  Q
    ||||||| || |||||    
12924938 attcttccaccgcctg 12924953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 65 - 113
Target Start/End: Original strand, 12924677 - 12924725
Alignment:
65 cttgaagcagggtctaatccagtacttggttcatccatataaacaacct 113  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||    
12924677 cttgacgcagggtctaatccagtacttggttcatccatataaacaacct 12924725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110498 times since January 2019
Visitors: 1335