View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_11_10 (Length: 71)

Name: J5_11_10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_11_10
J5_11_10
[»] chr8 (2 HSPs)
chr8 (1-34)||(32881944-32881977)
chr8 (1-34)||(32886182-32886215)


Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.00000000008; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 32881977 - 32881944
Alignment:
1 gtaaggaaattaaagggtgaggaatacaattaat 34  Q
    ||||||||||||||||||||||||||||||||||    
32881977 gtaaggaaattaaagggtgaggaatacaattaat 32881944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 32886215 - 32886182
Alignment:
1 gtaaggaaattaaagggtgaggaatacaattaat 34  Q
    ||||||||||||||||| ||||||||||||||||    
32886215 gtaaggaaattaaagggcgaggaatacaattaat 32886182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110460 times since January 2019
Visitors: 1335