View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_11_16 (Length: 97)

Name: J5_11_16
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_11_16
J5_11_16
[»] chr5 (2 HSPs)
chr5 (1-64)||(27841521-27841584)
chr5 (59-97)||(27841580-27841618)


Alignment Details
Target: chr5 (Bit Score: 60; Significance: 4e-26; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 27841584 - 27841521
Alignment:
1 caattaacataattgagatatagaagacaaaaattccacaattggaaggagagacttgattaat 64  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
27841584 caattaacataattgagatatagaagacaaaaattccacaattggaagaagagacttgattaat 27841521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 59 - 97
Target Start/End: Complemental strand, 27841618 - 27841580
Alignment:
59 attaattgttgcaatttgtgatatctaggagacccaatt 97  Q
    |||||||||||||||||||||||||||||||||||||||    
27841618 attaattgttgcaatttgtgatatctaggagacccaatt 27841580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361684 times since January 2019
Visitors: 488