View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_11_82 (Length: 316)

Name: J5_11_82
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_11_82
J5_11_82
[»] chr2 (1 HSPs)
chr2 (10-316)||(8003086-8003392)


Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 10 - 316
Target Start/End: Complemental strand, 8003392 - 8003086
Alignment:
10 caattgtggtccttgcacttcgtcatgttataagttacgtattcaccgaacgtgaaactgttgcaaatgcagtatcagatttgtgtccatacttggctgt 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
8003392 caattgtggtccttgcacttcgtcatgttataagttacgtattcaccgaaggtgaaactgttgcaaatgcagtatcagatttgtgtccatacttggctgt 8003293  T
110 cactctaattcttaatgggatccaaccagtgctttcaggtatacaaatataagagtaagaattttctcaatgaaaagagaaaatagttaaatgttatatt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8003292 cactctaattcttaatgggatccaaccagtgctttcaggtatacaaatataagagtaagaattttctcaatgaaaagagaaaatagttaaatgttatatt 8003193  T
210 attattttaaaaataaaaagatatgacaatattcactataacattttcgtcgtatgctaatgaaaaccaaatattatgaaaagttgtggaaaaatactga 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8003192 attattttaaaaataaaaagatatgacaatattcactataacattttcgtcgtatgctaatgaaaaccaaatattatgaaaagttgtggaaaaatactga 8003093  T
310 tgaagta 316  Q
    |||||||    
8003092 tgaagta 8003086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360380 times since January 2019
Visitors: 483