View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_11_83 (Length: 575)

Name: J5_11_83
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_11_83
J5_11_83
[»] chr8 (3 HSPs)
chr8 (50-416)||(12881285-12881651)
chr8 (413-573)||(12881698-12881858)
chr8 (308-407)||(12885648-12885747)
[»] chr7 (1 HSPs)
chr7 (133-168)||(28453542-28453577)


Alignment Details
Target: chr8 (Bit Score: 360; Significance: 0; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 50 - 416
Target Start/End: Complemental strand, 12881651 - 12881285
Alignment:
50 gtcttgaataatactgattcgtcacacagccaaacatgtaccaaaggttttgtttttcattgttttagttatcaggcaagcgagttggaattgttggatt 149  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12881651 gtcttgaataatactgattcgtcacacagccaaacatgtaccaaaggttttgtttttcattgttttagttatcaggcaagcgagttggaattgttggatt 12881552  T
150 aggaagtattggcatggaagttgccaagcgactcgagccatttgattgcattatctcgtacaantctaagcatcaaaaaacatcaatttcgtaccctttc 249  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
12881551 aggaagtattggcatggaagttgccaagcgactcgagtcatttgattgcattatctcgtacaactctaagcatcaaaaaacatcaatttcgtaccctttc 12881452  T
250 tattccaatgttattgatcttgcaacttctagcgacgcacttgtggtatgttgtgcactaaacaaccaaacacgacacatagtaaacaaagatgtccttt 349  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12881451 tattccaatgttattgatcttgcaacttctagcgacgcacttgtggtatgttgtgcactaaacaaccaaacacgacacatagtaaacaaagatgtccttt 12881352  T
350 tggcattaggaaaagaagggtttattgtaaatgttggaagaggtggtcttattgatgagaaacaatt 416  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12881351 tggcattaggaaaagaagggtttattgtaaatgttggaagaggtggtcttattgatgagaaacaatt 12881285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 116; E-Value: 1e-58
Query Start/End: Original strand, 413 - 573
Target Start/End: Complemental strand, 12881858 - 12881698
Alignment:
413 aattcaggttgccngtgctggaggagttttctcggangatgtggctgatgtggcagtggcnttgctgattgctgtcatgaggaangtgacggnggcnaat 512  Q
    ||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||| |||    
12881858 aattcaggttgccggtgctggaggagttttctcggaggatgtggctgatgtggcagtggcgttgctgattgctgtcatgaggaaggtgacggtggcgaat 12881759  T
513 ccgtatgtgangacgcggcgggnangttctgatccctgggaattcccncttgganacaagg 573  Q
    | |||||||| ||||||||||| | |||||||||| ||||| ||||| |||||| ||||||    
12881758 cggtatgtgaggacgcggcgggaacgttctgatccttgggatttccctcttggatacaagg 12881698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 308 - 407
Target Start/End: Complemental strand, 12885747 - 12885648
Alignment:
308 taaacaaccaaacacgacacatagtaaacaaagatgtccttttggcattaggaaaagaagggtttattgtaaatgttggaagaggtggtcttattgatga 407  Q
    ||||| |||||||| | ||||| || |||||||| ||| | |||||||| ||||||| |||  | || || |||||||||||||||| ||| ||||||||    
12885747 taaacgaccaaacaaggcacattgtcaacaaagaagtcatgttggcattgggaaaaggaggaatcatagtgaatgttggaagaggtgctctcattgatga 12885648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 133 - 168
Target Start/End: Original strand, 28453542 - 28453577
Alignment:
133 gttggaattgttggattaggaagtattggcatggaa 168  Q
    ||||||||||||||||||||||| ||||||||||||    
28453542 gttggaattgttggattaggaagcattggcatggaa 28453577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111165 times since January 2019
Visitors: 1335