View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_11_85 (Length: 389)

Name: J5_11_85
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_11_85
J5_11_85
[»] chr4 (3 HSPs)
chr4 (1-244)||(22036142-22036385)
chr4 (241-389)||(22035998-22036146)
chr4 (14-47)||(50012157-50012190)
[»] scaffold0323 (1 HSPs)
scaffold0323 (158-244)||(9411-9497)
[»] chr8 (1 HSPs)
chr8 (14-47)||(44109197-44109230)
[»] chr2 (1 HSPs)
chr2 (345-389)||(45641604-45641648)


Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 22036142 - 22036385
Alignment:
1 cacttctcctgctgatcatgcgtaaaatctatattttgactaccttgcatatataagtacacatagacatgtacatgtacatgaattggaatactataaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22036142 cacttctcctgctgatcatgcgtaaaatctatattttgactaccttgcatatataagtacacatagacatgtacatgtacatgaattggaatactataaa 22036241  T
101 tagtctaatattcttaattctcctttctattttcttatctaagataagtatttaattaatacacatgagatgtcagaaggttggctcaattttagaacaa 200  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
22036242 tagtctaatatttttaattctcctttctattttcttatctaagataagtatttaattaatacacatgagatgtcaaaaggttggctcaattttagaacaa 22036341  T
201 atgcagaaaggattttcattaggattttagtaaatcaaacaatt 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
22036342 atgcagaaaggattttcattaggattttagtaaatcaaacaatt 22036385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 241 - 389
Target Start/End: Original strand, 22035998 - 22036146
Alignment:
241 aattcatccgtgagcgagacaatgcgagttagagagagatctgggagaccaagttaatgatgcatacatatgaattgacatgcttatatttgagaaatat 340  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22035998 aattcatccgtgagcgagacaatgcgagttagagagagatctgggagaccaagttaatgatgcatacatatgaattgacatgcttatatttgagaaatat 22036097  T
341 gagtttttgtataatcttactattaatgttacgatttacgatttcactt 389  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
22036098 gagtttttgtataatcttactattaatgttacgatttacgatttcactt 22036146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 14 - 47
Target Start/End: Original strand, 50012157 - 50012190
Alignment:
14 gatcatgcgtaaaatctatattttgactaccttg 47  Q
    |||||||||||||||||| |||||||||||||||    
50012157 gatcatgcgtaaaatctagattttgactaccttg 50012190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0323 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0323
Description:

Target: scaffold0323; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 9497 - 9411
Alignment:
158 aatacacatgagatgtcagaaggttggctcaattttagaacaaatgcagaaaggattttcattaggattttagtaaatcaaacaatt 244  Q
    |||||||||||| || ||||||||| ||||| ||||||||  |||||| ||  |||| |||  | | ||||||||||||||||||||    
9497 aatacacatgaggtgccagaaggtttgctcagttttagaatgaatgcaaaagagattctcacaaagtttttagtaaatcaaacaatt 9411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 14 - 47
Target Start/End: Original strand, 44109197 - 44109230
Alignment:
14 gatcatgcgtaaaatctatattttgactaccttg 47  Q
    |||||||||||||||||| |||||||||||||||    
44109197 gatcatgcgtaaaatctagattttgactaccttg 44109230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 345 - 389
Target Start/End: Complemental strand, 45641648 - 45641604
Alignment:
345 ttttgtataatcttactattaatgttacgatttacgatttcactt 389  Q
    |||||||||||||||| |||| ||||| |||||||||||| ||||    
45641648 ttttgtataatcttacgattactgttaggatttacgattttactt 45641604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110828 times since January 2019
Visitors: 1335