View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_11_86 (Length: 222)

Name: J5_11_86
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_11_86
J5_11_86
[»] chr5 (20 HSPs)
chr5 (44-222)||(41316908-41317086)
chr5 (44-222)||(41328949-41329127)
chr5 (44-208)||(41337703-41337867)
chr5 (44-208)||(41324986-41325150)
chr5 (44-199)||(41305243-41305398)
chr5 (45-222)||(41311113-41311290)
chr5 (45-222)||(41332882-41333059)
chr5 (44-201)||(31177750-31177907)
chr5 (44-208)||(31187813-31187977)
chr5 (44-208)||(31225801-31225965)
chr5 (44-211)||(41287085-41287252)
chr5 (44-201)||(41367082-41367239)
chr5 (1-52)||(41316861-41316912)
chr5 (2-52)||(41328902-41328952)
chr5 (8-52)||(41332835-41332879)
chr5 (1-52)||(41287027-41287078)
chr5 (1-52)||(41367014-41367065)
chr5 (2-48)||(41311070-41311116)
chr5 (1-48)||(31177924-31177971)
chr5 (10-52)||(31187996-31188038)
[»] chr4 (2 HSPs)
chr4 (44-211)||(17248630-17248797)
chr4 (1-51)||(17248804-17248854)


Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 20)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 44 - 222
Target Start/End: Complemental strand, 41317086 - 41316908
Alignment:
44 atcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaaccctt 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41317086 atcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaaccctt 41316987  T
144 gtcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaactaacaatggagcaacaggat 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41316986 gtcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaactaacaatggagcaacaggat 41316908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 44 - 222
Target Start/End: Complemental strand, 41329127 - 41328949
Alignment:
44 atcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaaccctt 143  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||    ||||||    
41329127 atcaattggactattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttgaatctcttccaatagcccaagcattaaccattaccctt 41329028  T
144 gtcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaactaacaatggagcaacaggat 222  Q
    ||||| ||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||    
41329027 gtcttagctgggatttcatacccattgatttggcatctctccctactttctcttggaactaacaatggtgcaacgggat 41328949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 44 - 208
Target Start/End: Complemental strand, 41337867 - 41337703
Alignment:
44 atcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaaccctt 143  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||    
41337867 atcaattgagctattaacaaacctctcaggtttaaaactctcagcttcaacccaatactttggatctcttccaattgcccaaacattgacagcaaccctt 41337768  T
144 gtcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaactaacaa 208  Q
    ||||| ||||| |||||||| ||||||||||  |||||||| ||||||||||||||||| |||||    
41337767 gtcttagctgggatctcatacccattgatttcacatctctctctactttctcttggaaccaacaa 41337703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 44 - 208
Target Start/End: Complemental strand, 41325150 - 41324986
Alignment:
44 atcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaaccctt 143  Q
    ||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||    ||||||    
41325150 atcaattggactattaacaaacctctcaggtttaaaactttcagcatcaacccaataccttggatctcttccaatagcccaagcattaaccatgaccctt 41325051  T
144 gtcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaactaacaa 208  Q
    ||||| ||||| || ||||| ||||||||||||||||||||||||||||||||||||| ||||||    
41325050 gtcttagctgggatttcatacccattgatttggcatctctccctactttctcttggaagtaacaa 41324986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 44 - 199
Target Start/End: Complemental strand, 41305398 - 41305243
Alignment:
44 atcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaaccctt 143  Q
    |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||  ||||||     
41305398 atcaattgagctattaacaaacctctcgggtttaaaactctcagcttcaacccaatactttggatctcttccaatcgcccaagcattgacaataacccta 41305299  T
144 gtcttggctggaatctcataaccattgatttggcatctctccctactttctcttgg 199  Q
    ||||| |||||||| |||||  ||||||||||||| ||||||||||||||||||||    
41305298 gtcttagctggaatatcatactcattgatttggcaactctccctactttctcttgg 41305243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 45 - 222
Target Start/End: Complemental strand, 41311290 - 41311113
Alignment:
45 tcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaacccttg 144  Q
    ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | | | | || ||||    
41311290 tcaattgtgctattaacaaacctctcaggtttaaatctctcagcttcaacccaataccttggatctcttccaatagcccaagcaataataacgactcttg 41311191  T
145 tcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaactaacaatggagcaacaggat 222  Q
    ||||   ||| |||||||  | ||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||    
41311190 tcttaattgggatctcatgcctattaatttggcatctctccctactttctcttggaactaacaatggtgcaactggat 41311113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 45 - 222
Target Start/End: Complemental strand, 41333059 - 41332882
Alignment:
45 tcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaacccttg 144  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||    |||||||    
41333059 tcaattgtgctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttgaatctcttccaatagcccaagcattaaccattacccttg 41332960  T
145 tcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaactaacaatggagcaacaggat 222  Q
    |||| ||||| || ||||| ||||| |||||||||  || | ||||||||||||||| ||||||||| ||||| ||||    
41332959 tcttagctgggatttcatacccattaatttggcatggcttcatactttctcttggaattaacaatggtgcaacgggat 41332882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 44 - 201
Target Start/End: Original strand, 31177750 - 31177907
Alignment:
44 atcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaaccctt 143  Q
    |||||||| |||||||||||||||||| ||||||||||||||||||||  |||||||||||  |||||||||||| |||||| |||||| |||||| |||    
31177750 atcaattgtgctattaacaaacctctcgggtttaaaactctcagcttctgcccaatacctttcatctcttccaattgcccaaacattgatagcaactctt 31177849  T
144 gtcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaa 201  Q
    || || ||||| || ||||| |||||||||||||||||||| ||||||||||||||||    
31177850 gttttagctgggatttcatacccattgatttggcatctctctctactttctcttggaa 31177907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 44 - 208
Target Start/End: Original strand, 31187813 - 31187977
Alignment:
44 atcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaaccctt 143  Q
    |||||||| |||||| | ||||||||||||||||||||||||||||||  |||||||||||  |||||||||||| |||||| |||||| |||||| |||    
31187813 atcaattgtgctattgagaaacctctcaggtttaaaactctcagcttctgcccaatacctttcatctcttccaattgcccaaacattgatagcaactctt 31187912  T
144 gtcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaactaacaa 208  Q
    || || ||||| || ||||| |||||||||||||||||||| ||||||||||||||||| |||||    
31187913 gttttagctgggatttcatacccattgatttggcatctctctctactttctcttggaaccaacaa 31187977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 44 - 208
Target Start/End: Complemental strand, 31225965 - 31225801
Alignment:
44 atcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaaccctt 143  Q
    |||||||| |||||| | ||||||||||||||||||||||||||||||  |||||||||||  |||||||||||| |||||| |||||| |||||| |||    
31225965 atcaattgtgctattgagaaacctctcaggtttaaaactctcagcttctgcccaatacctttcatctcttccaattgcccaaacattgatagcaactctt 31225866  T
144 gtcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaactaacaa 208  Q
    || || ||||| || ||||| |||||||||||||||||||| ||||||||||||||||| |||||    
31225865 gttttagctgggatttcatacccattgatttggcatctctctctactttctcttggaaccaacaa 31225801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 44 - 211
Target Start/End: Complemental strand, 41287252 - 41287085
Alignment:
44 atcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaaccctt 143  Q
    ||||||||| ||||||||||||||||| ||||| ||| |||||||||| |||||||| ||||||||||||||||| |||||||||||||||  ||||||     
41287252 atcaattggactattaacaaacctctcgggtttgaaattctcagcttcgacccaatatcttggatctcttccaattgcccaagcattgacaagaacccta 41287153  T
144 gtcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaactaacaatgg 211  Q
    |||||||| || || ||||| ||||| |||||||||  || | |||||||||||||||  ||||||||    
41287152 gtcttggccgggatatcatatccattaatttggcatggcttcatactttctcttggaatcaacaatgg 41287085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 44 - 201
Target Start/End: Complemental strand, 41367239 - 41367082
Alignment:
44 atcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaaccctt 143  Q
    ||||||| ||||||||| ||| |||||||| ||||||||||  || |||||||||||||| |||||||||||||||||||||||||| |||   ||||||    
41367239 atcaattcggctattaagaaatctctcaggcttaaaactcttggcatcaacccaatacctcggatctcttccaatagcccaagcattaacaatgaccctt 41367140  T
144 gtcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaa 201  Q
    ||||| ||||| || ||||| | ||| |||||||||  || | |||||||||||||||    
41367139 gtcttagctgggatatcatatctatttatttggcatggcttcgtactttctcttggaa 41367082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 41316912 - 41316861
Alignment:
1 aggatacaacctcaatgtttctttgatgacagactttaagtatatcaattgg 52  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
41316912 aggatacaacctcaatgtttctttgatgacagactttaagtatatcaattgg 41316861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 52
Target Start/End: Complemental strand, 41328952 - 41328902
Alignment:
2 ggatacaacctcaatgtttctttgatgacagactttaagtatatcaattgg 52  Q
    |||| |||||||||||||||||||||||| |||||||||||||||||||||    
41328952 ggatgcaacctcaatgtttctttgatgacggactttaagtatatcaattgg 41328902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 41332879 - 41332835
Alignment:
8 aacctcaatgtttctttgatgacagactttaagtatatcaattgg 52  Q
    ||||||||||||||||||| |||||||||||||||||||||||||    
41332879 aacctcaatgtttctttgacgacagactttaagtatatcaattgg 41332835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 41287078 - 41287027
Alignment:
1 aggatacaacctcaatgtttctttgatgacagactttaagtatatcaattgg 52  Q
    ||||| |||||||| |||||||||||| |||||||| |||||||||||||||    
41287078 aggatgcaacctcattgtttctttgataacagacttcaagtatatcaattgg 41287027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 41367065 - 41367014
Alignment:
1 aggatacaacctcaatgtttctttgatgacagactttaagtatatcaattgg 52  Q
    ||||| |||||||| ||||||||||||||| || ||||||||||||||||||    
41367065 aggatgcaacctcattgtttctttgatgacggattttaagtatatcaattgg 41367014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 2 - 48
Target Start/End: Complemental strand, 41311116 - 41311070
Alignment:
2 ggatacaacctcaatgtttctttgatgacagactttaagtatatcaa 48  Q
    |||| |||||||| |||||||||||||||| ||||||||||||||||    
41311116 ggatgcaacctcagtgtttctttgatgacaaactttaagtatatcaa 41311070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 31177924 - 31177971
Alignment:
1 aggatacaacctcaatgtttctttgatgacagactttaagtatatcaa 48  Q
    ||||| |||||| |||||||||||||| | ||||||||||||||||||    
31177924 aggatgcaaccttaatgtttctttgattatagactttaagtatatcaa 31177971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 31187996 - 31188038
Alignment:
10 cctcaatgtttctttgatgacagactttaagtatatcaattgg 52  Q
    ||||||||||||| |||| | ||||||||||||||||||||||    
31187996 cctcaatgtttctctgattatagactttaagtatatcaattgg 31188038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 44 - 211
Target Start/End: Original strand, 17248630 - 17248797
Alignment:
44 atcaattgggctattaacaaacctctcaggtttaaaactctcagcttcaacccaataccttggatctcttccaatagcccaagcattgacagcaaccctt 143  Q
    ||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||| |||| ||||||||||||    
17248630 atcaattgggctattaaaaaacctttcaggtttgaaactctcagcttcaacccaatacctttgatctcttccaattgcccaaacattaacagcaaccctt 17248729  T
144 gtcttggctggaatctcataaccattgatttggcatctctccctactttctcttggaactaacaatgg 211  Q
    ||||| |||||||| ||||| || |||||| | ||| | |||||||||| ||| ||||  ||||||||    
17248730 gtcttagctggaatatcatacccgttgattcgacatttttccctactttgtctaggaatcaacaatgg 17248797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 17248804 - 17248854
Alignment:
1 aggatacaacctcaatgtttctttgatgacagactttaagtatatcaattg 51  Q
    ||||| || ||||| |||||||||||||||||| ||||||||||| |||||    
17248804 aggatgcagcctcagtgtttctttgatgacagaatttaagtatattaattg 17248854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126341 times since January 2019
Visitors: 1390