View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_11_88 (Length: 126)
Name: J5_11_88
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5_11_88 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 45; Significance: 4e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 34 - 78
Target Start/End: Original strand, 1203227 - 1203271
Alignment:
Q |
34 |
aattgtattcttaagagcacttaattttctaattgttatgttaac |
78 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1203227 |
aattgtattcttaagagcacttaattttctaattgttatgttaac |
1203271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 1203315 - 1203351
Alignment:
Q |
1 |
ttgtcaaggcctgcaacatctcttcaataatggaatt |
37 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
1203315 |
ttgtcaaggcctgcaacatctcttcaataatggaatt |
1203351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 36 - 77
Target Start/End: Complemental strand, 52178778 - 52178737
Alignment:
Q |
36 |
ttgtattcttaagagcacttaattttctaattgttatgttaa |
77 |
Q |
|
|
|||||||||| ||||||||| ||||||||||||||| ||||| |
|
|
T |
52178778 |
ttgtattctttagagcactttattttctaattgttaagttaa |
52178737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 361887 times since January 2019
Visitors: 488