View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_11_88 (Length: 126)

Name: J5_11_88
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_11_88
J5_11_88
[»] chr5 (2 HSPs)
chr5 (34-78)||(1203227-1203271)
chr5 (1-37)||(1203315-1203351)
[»] chr1 (1 HSPs)
chr1 (36-77)||(52178737-52178778)


Alignment Details
Target: chr5 (Bit Score: 45; Significance: 4e-17; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 34 - 78
Target Start/End: Original strand, 1203227 - 1203271
Alignment:
34 aattgtattcttaagagcacttaattttctaattgttatgttaac 78  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
1203227 aattgtattcttaagagcacttaattttctaattgttatgttaac 1203271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 1203315 - 1203351
Alignment:
1 ttgtcaaggcctgcaacatctcttcaataatggaatt 37  Q
    |||||||||||||||||||||||||||||||||||||    
1203315 ttgtcaaggcctgcaacatctcttcaataatggaatt 1203351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 36 - 77
Target Start/End: Complemental strand, 52178778 - 52178737
Alignment:
36 ttgtattcttaagagcacttaattttctaattgttatgttaa 77  Q
    |||||||||| ||||||||| ||||||||||||||| |||||    
52178778 ttgtattctttagagcactttattttctaattgttaagttaa 52178737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361887 times since January 2019
Visitors: 488