View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_11_89 (Length: 631)

Name: J5_11_89
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_11_89
J5_11_89
[»] chr5 (2 HSPs)
chr5 (1-614)||(24888901-24889515)
chr5 (133-196)||(24899707-24899770)
[»] chr1 (1 HSPs)
chr1 (315-596)||(22857044-22857315)
[»] chr4 (3 HSPs)
chr4 (312-450)||(39869376-39869514)
chr4 (439-594)||(39870311-39870467)
chr4 (239-307)||(39869257-39869325)
[»] chr2 (4 HSPs)
chr2 (374-455)||(33163013-33163095)
chr2 (312-366)||(33162202-33162256)
chr2 (243-308)||(33162087-33162152)
chr2 (506-588)||(33163126-33163209)


Alignment Details
Target: chr5 (Bit Score: 540; Significance: 0; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 540; E-Value: 0
Query Start/End: Original strand, 1 - 614
Target Start/End: Complemental strand, 24889515 - 24888901
Alignment:
1 tcaacaagctcaacaatttctgcatttcttgcttatattcaaattaaataattaccggactcnctatctccatattctgcatagcaggttaatgttacta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
24889515 tcaacaagctcaacaatttctgcatttcttgcttatattcaaattaaataattaccggactcactatctccatattctgcatagcaggttaatgttacta 24889416  T
101 ctttgtggcttgtcaaggacgatctccgataaacaaatcaagaatagcaaatgtagaacatatcgaaaacagatcaagaaaaggtggacggcctatnnnn 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        
24889415 ctttgtggcttgtcaaggacgatctccgataaacaaatcaagaatagcaaatgtagaacatatcgaaaacagatcaagaaaaggtggacggcctataaaa 24889316  T
201 nnngataagtaattagtacttagtagtacttcattccgacattcaacctaagttaacagctacaacgacacatattcttcaccatataacttccagaatt 300  Q
       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24889315 aaagataagtaattagtacttagtagtacttcattccgacattcaacctaagttaacagctacaacgacacatattcttcaccatataacttccagaatt 24889216  T
301 tttctaaacattacatatgaacacatacatatttttagttccacaaaaatcattatagaaaagtgtggagtcaattaaactataagtggtttttagaact 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
24889215 tttctaaacattacatatgaacacatacatatttttagttccacaaaaatcattatagaaaagtgtggagtcaattaaactataactggtttttagaact 24889116  T
401 ttttacataaaaactagttgaacattttatcacatttgacccaccaaatgacctcagattcaaacnaaggtaacataagtaaactaatagttctactctt 500  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
24889115 ttttacataaaaactagttgaacattttatcacatttgacccaccaaatgacctcagattcaaacaaaggtaacataagtaaactaatagttctactctt 24889016  T
501 tggagaattaaagataaatcnatccagaaatttcnaatgac-aactctttaccttaacaaaaccncataagcaacaaacttcnaaatcccnttagaggng 599  Q
    |||||||||||||||||||| ||| ||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||  |    
24889015 tggagaattaaagataaatcaatcaagaaatttcaaatgacaaactctttaccttaacaaaaccacataagcaacaaacttcaaaatcccattagagagg 24888916  T
600 gacnaaatgngaaca 614  Q
     || ||||| |||||    
24888915 aacaaaatgagaaca 24888901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 133 - 196
Target Start/End: Complemental strand, 24899770 - 24899707
Alignment:
133 acaaatcaagaatagcaaatgtagaacatatcgaaaacagatcaagaaaaggtggacggcctat 196  Q
    ||||| ||||||||||||| |||||||| |||||||||||| |||| ||||| ||| |||||||    
24899770 acaaagcaagaatagcaaaagtagaacagatcgaaaacagaccaaggaaaggcggaaggcctat 24899707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 118; Significance: 7e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 118; E-Value: 7e-60
Query Start/End: Original strand, 315 - 596
Target Start/End: Complemental strand, 22857315 - 22857044
Alignment:
315 atatgaacacatacatatttttagttccacaaaaatcattatagaaaagtgtggagtcaattaaactataagtggtttttagaactttttacataaaaac 414  Q
    |||||||||||||||||||||||| ||||||||||| ||||||||||||||| || ||||||||| || || || |||||||| ||||||||||||||||    
22857315 atatgaacacatacatatttttagctccacaaaaattattatagaaaagtgtagaatcaattaaa-tagaattgctttttagagctttttacataaaaac 22857217  T
415 tagttgaacattttatcacatttgacccaccaaatgacctcagattcaaacnaaggtaacataagtaaactaatagttctactctttggagaattaaaga 514  Q
     |||||||||||||          ||||||||||||||||| ||||||||| |||||||||||| ||||||||||||| ||||||||||||||||| |||    
22857216 cagttgaacatttt----------acccaccaaatgacctcggattcaaacaaaggtaacataaataaactaatagttttactctttggagaattagaga 22857127  T
515 taaatcnatccagaaatttcnaatga-caactctttaccttaacaaaaccncataagcaacaaacttcnaaatcccnttagag 596  Q
     ||||| ||| ||||||||  |||||   | | |||| |  ||||||||| ||||||||| ||||||| ||||||| ||||||    
22857126 aaaatcaatcaagaaattttaaatgatgtaatttttatcggaacaaaaccacataagcaataaacttcaaaatcccattagag 22857044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 111; Significance: 1e-55; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 312 - 450
Target Start/End: Original strand, 39869376 - 39869514
Alignment:
312 tacatatgaacacatacatatttttagttccacaaaaatcattatagaaaagtgtggagtcaattaaactataagtggtttttagaactttttacataaa 411  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| || |||||||| |||||||||||||    
39869376 tacatatcaacacatacatatttttagttccacaaaaatcattatagaaaagtgtagaatcaattaaactataattgatttttagagctttttacataaa 39869475  T
412 aactagttgaacattttatcacatttgacccaccaaatg 450  Q
    ||||||||||||||||||||||||||||| |||||||||    
39869476 aactagttgaacattttatcacatttgactcaccaaatg 39869514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 439 - 594
Target Start/End: Original strand, 39870311 - 39870467
Alignment:
439 acccaccaaatgacctcagattcaaacnaaggtaacataagtaaactaatagttctactctttggagaattaaagataaatcnatccagaaatttcnaat 538  Q
    ||||||||||||||||| ||||||||| |||||||||||| |  |||| ||||| ||||||||||||||||||||| ||||| ||  ||||||||| |||    
39870311 acccaccaaatgacctcggattcaaacaaaggtaacataaatgtactattagttttactctttggagaattaaagaaaaatcaataaagaaatttcaaat 39870410  T
539 gac-aactctttaccttaacaaaaccncataagcaacaaacttcnaaatcccnttag 594  Q
    ||| || | ||||||  ||||||||| ||||||||||||||||| ||||||| ||||    
39870411 gacaaaatttttaccgaaacaaaaccacataagcaacaaacttcaaaatcccattag 39870467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 239 - 307
Target Start/End: Original strand, 39869257 - 39869325
Alignment:
239 acattcaacctaagttaacagctacaacgacacatattcttcaccatataacttccagaatttttctaa 307  Q
    |||||||||| ||||||||| ||||||||||||||||| | ||||||| |||||| |||||||||||||    
39869257 acattcaaccaaagttaacaactacaacgacacatattatgcaccatacaacttcaagaatttttctaa 39869325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 59; Significance: 1e-24; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 374 - 455
Target Start/End: Original strand, 33163013 - 33163095
Alignment:
374 attaaactataagtggtttttagaactttttacataaaa-actagttgaacattttatcacatttgacccaccaaatgacctc 455  Q
    |||||||||||| |||||||| || ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||    
33163013 attaaactataactggtttttggagcttttaacataaaaaactagttgaacattttatcacatttgacccaccaaatgacctc 33163095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 312 - 366
Target Start/End: Original strand, 33162202 - 33162256
Alignment:
312 tacatatgaacacatacatatttttagttccacaaaaatcattatagaaaagtgt 366  Q
    |||||||||| |||||| |||||||||||||||||||||||||||||||||||||    
33162202 tacatatgaagacatacttatttttagttccacaaaaatcattatagaaaagtgt 33162256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 243 - 308
Target Start/End: Original strand, 33162087 - 33162152
Alignment:
243 tcaacctaagttaacagctacaacgacacatattcttcaccatataacttccagaatttttctaaa 308  Q
    |||||| || ||||||||||||||||||||| |||| |||| |||||| || ||||||||||||||    
33162087 tcaaccaaaattaacagctacaacgacacattttctgcaccgtataacatcaagaatttttctaaa 33162152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 506 - 588
Target Start/End: Original strand, 33163126 - 33163209
Alignment:
506 aattaaagataaatcnatccagaaatttcnaatgacaa-ctctttaccttaacaaaaccncataagcaacaaacttcnaaatcc 588  Q
    ||||| ||| ||||| ||| ||||||||| |||||||| || ||||||  ||||||||| ||||||||||||||||  ||||||    
33163126 aattagagaaaaatcaatcaagaaatttcaaatgacaaactttttaccggaacaaaaccacataagcaacaaactttaaaatcc 33163209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361337 times since January 2019
Visitors: 487