View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_11_90 (Length: 321)

Name: J5_11_90
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_11_90
J5_11_90
[»] chr3 (4 HSPs)
chr3 (123-299)||(44448701-44448877)
chr3 (128-293)||(48612308-48612473)
chr3 (1-49)||(44448950-44448998)
chr3 (235-281)||(49147775-49147821)
[»] chr1 (2 HSPs)
chr1 (123-299)||(24601539-24601715)
chr1 (222-296)||(23204398-23204472)
[»] chr2 (3 HSPs)
chr2 (123-299)||(7817992-7818168)
chr2 (123-299)||(1485207-1485383)
chr2 (235-280)||(35297130-35297175)
[»] chr7 (2 HSPs)
chr7 (123-299)||(23906449-23906625)
chr7 (123-299)||(9003368-9003544)
[»] chr4 (5 HSPs)
chr4 (123-299)||(7429923-7430099)
chr4 (123-299)||(7555832-7556008)
chr4 (123-266)||(395610-395753)
chr4 (208-296)||(8533530-8533618)
chr4 (223-275)||(55719679-55719731)
[»] chr5 (2 HSPs)
chr5 (174-296)||(19860052-19860174)
chr5 (222-296)||(27601365-27601439)
[»] scaffold0015 (1 HSPs)
scaffold0015 (235-280)||(14066-14111)
[»] chr8 (1 HSPs)
chr8 (248-296)||(16700323-16700371)


Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 123 - 299
Target Start/End: Complemental strand, 44448877 - 44448701
Alignment:
123 ctagctcctaaggaacaaagctcccatctcatctgtcaaaagcagcgacagcaggtcttcaggaagagatgagtagacagttaaatcaacatctgttgta 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44448877 ctagctcctaaggaacaaagctcccatctcatctgtcaaaagcagcgacagcaggtcttcaggaagagatgagtagacagttaaatcaacatctgttgta 44448778  T
223 gctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttcttgaatt 299  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44448777 gctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttcttgaatt 44448701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 128 - 293
Target Start/End: Complemental strand, 48612473 - 48612308
Alignment:
128 tcctaaggaacaaagctcccatctcatctgtcaaaagcagcgacagcaggtcttcaggaagagatgagtagacagttaaatcaacatctgttgtagctcc 227  Q
    ||||||||||||||| |||||||||||||||   |||||||  |||||||| ||||||| ||||||||| ||||||||||||||||| | ||||||| ||    
48612473 tcctaaggaacaaagttcccatctcatctgtgctaagcagcagcagcaggttttcaggaggagatgagtggacagttaaatcaacatatattgtagcccc 48612374  T
228 tagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttct 293  Q
    |||||||||||||||||  ||||||||||| |||||||||||||||||||| || |||||||||||    
48612373 tagcttcgccataaagttcgcacaatgattgccctctctaagcgagtgatggatggagtaatttct 48612308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 44448998 - 44448950
Alignment:
1 gaagcatagggacactctaaggggtattcgcaaatttcctaataaacta 49  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
44448998 gaagcatagggacactctaaggggtattcgcaaatttcctaataaacta 44448950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 281
Target Start/End: Original strand, 49147775 - 49147821
Alignment:
235 gccataaagtctgcacaatgattaccctctctaagcgagtgatgaat 281  Q
    ||||||||||||||||| ||||| ||||||||||| |||||||||||    
49147775 gccataaagtctgcacactgatttccctctctaagtgagtgatgaat 49147821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 123 - 299
Target Start/End: Complemental strand, 24601715 - 24601539
Alignment:
123 ctagctcctaaggaacaaagctcccatctcatctgtcaaaagcagcgacagcaggtcttcaggaagagatgagtagacagttaaatcaacatctgttgta 222  Q
    |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
24601715 ctagttcctaaggaacaaagttcccatctcatctgtcaaaagcagcgacagcaggtcttcaggaggagatgagtagacagttaaatcaacatctgttgta 24601616  T
223 gctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttcttgaatt 299  Q
    |||||||||||||||||||||||  ||||||||||||||||||| ||||||||||||||||||||||||||||||||    
24601615 gctcctagcttcgccataaagtccacacaatgattaccctctctgagcgagtgatgaatagagtaatttcttgaatt 24601539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 222 - 296
Target Start/End: Complemental strand, 23204472 - 23204398
Alignment:
222 agctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttcttga 296  Q
    ||||| ||||||  |||| || || ||||| |||||||| |||||||||||||| |||| |||| ||||||||||    
23204472 agctcatagcttaaccatgaaatccgcacactgattaccttctctaagcgagtgttgaagagagaaatttcttga 23204398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 149; Significance: 1e-78; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 123 - 299
Target Start/End: Complemental strand, 7818168 - 7817992
Alignment:
123 ctagctcctaaggaacaaagctcccatctcatctgtcaaaagcagcgacagcaggtcttcaggaagagatgagtagacagttaaatcaacatctgttgta 222  Q
    |||| ||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||    
7818168 ctagttcctaaggaacaaagttcccatctcatctatcaaaagcagcgacagcatgtcttcaggaggagatgagtagacagttaaatcaacatctgttgta 7818069  T
223 gctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttcttgaatt 299  Q
    ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||    
7818068 gctcctagcttcgccataaagtccgcacaatgattaccctctctgagcgagtgatgaatagagtaatttcttgaatt 7817992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 123 - 299
Target Start/End: Original strand, 1485207 - 1485383
Alignment:
123 ctagctcctaaggaacaaagctcccatctcatctgtcaaaagcagcgacagcaggtcttcaggaagagatgagtagacagttaaatcaacatctgttgta 222  Q
    |||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
1485207 ctagttcctaaggaataaagttcccatctcatctgtcaaaagcagcgacagcaggtcttcaagaagagatgagtagacagttaaatcaacatctgttgta 1485306  T
223 gctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttcttgaatt 299  Q
    |||||||||||||||| ||||||  ||||||||||||||| ||| | ||||||||||||| ||||||||||||||||    
1485307 gctcctagcttcgccacaaagtccacacaatgattaccctatctgaacgagtgatgaataaagtaatttcttgaatt 1485383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 280
Target Start/End: Complemental strand, 35297175 - 35297130
Alignment:
235 gccataaagtctgcacaatgattaccctctctaagcgagtgatgaa 280  Q
    ||||||||||||||||| ||||| |||||||| || ||||||||||    
35297175 gccataaagtctgcacactgatttccctctctgagtgagtgatgaa 35297130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 123 - 299
Target Start/End: Original strand, 23906449 - 23906625
Alignment:
123 ctagctcctaaggaacaaagctcccatctcatctgtcaaaagcagcgacagcaggtcttcaggaagagatgagtagacagttaaatcaacatctgttgta 222  Q
    |||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||    
23906449 ctagttcctaaggaacaaagtttccatctcatctgtcaaaagcagcgacagcaggtcttcagaaggagaggagtagacagttaaatcaacatctgttgta 23906548  T
223 gctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttcttgaatt 299  Q
    ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||    
23906549 gctcctagcttcgccataaagtccgcacaatgattaccctctctgagcgagtgatgaatagagtaatttcttgaatt 23906625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 123 - 299
Target Start/End: Original strand, 9003368 - 9003544
Alignment:
123 ctagctcctaaggaacaaagctcccatctcatctgtcaaaagcagcgacagcaggtcttcaggaagagatgagtagacagttaaatcaacatctgttgta 222  Q
    |||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||||||||    
9003368 ctagttcctaaggaacaaagttcccatctcatctgtcaaaagcagcgacaacaggtcttcaggaggatatgagtagacagttaaatcaacatctgttgta 9003467  T
223 gctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttcttgaatt 299  Q
    ||||||||||||||||||||||| ||||||||| |||||||| | ||||||||||||||||||||||||||||||||    
9003468 gctcctagcttcgccataaagtccgcacaatgactaccctctttgagcgagtgatgaatagagtaatttcttgaatt 9003544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 137; Significance: 2e-71; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 123 - 299
Target Start/End: Original strand, 7429923 - 7430099
Alignment:
123 ctagctcctaaggaacaaagctcccatctcatctgtcaaaagcagcgacagcaggtcttcaggaagagatgagtagacagttaaatcaacatctgttgta 222  Q
    |||| ||||||||||||| | ||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||    
7429923 ctagttcctaaggaacaaggttcccatctcatctgtcaaaaggagcgacaacaggtcttcaggaggagatgagtagacagttaaatcaacatctgttgta 7430022  T
223 gctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttcttgaatt 299  Q
    | ||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||||||||||||||||||    
7430023 gatcctagcttcgccataaagtccgcacaatgattaccctctatgagcgagtgatgaatagagtaatttcttgaatt 7430099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 123 - 299
Target Start/End: Complemental strand, 7556008 - 7555832
Alignment:
123 ctagctcctaaggaacaaagctcccatctcatctgtcaaaagcagcgacagcaggtcttcaggaagagatgagtagacagttaaatcaacatctgttgta 222  Q
    |||| ||||||||||||||| || |||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||    
7556008 ctagatcctaaggaacaaagttctcatctcatatgtcaaaagcagcgacagcagatcttcaggatgagatgagtagacagttaaatcaacatcttttgta 7555909  T
223 gctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttcttgaatt 299  Q
    ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||    
7555908 gctcctagcttcgccataaagtctgcacaatgattacccactctgagcgagtgatgaataaagtaatttcttgaatt 7555832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 123 - 266
Target Start/End: Original strand, 395610 - 395753
Alignment:
123 ctagctcctaaggaacaaagctcccatctcatctgtcaaaagcagcgacagcaggtcttcaggaagagatgagtagacagttaaatcaacatctgttgta 222  Q
    |||| |||||||||| |||| |||||||||||||||||||||||||||||| || |||| |||| |||||||||||||||||||||||||||| ||||||    
395610 ctagttcctaaggaataaagttcccatctcatctgtcaaaagcagcgacagtagatctttaggaggagatgagtagacagttaaatcaacatcagttgta 395709  T
223 gctcctagcttcgccataaagtctgcacaatgattaccctctct 266  Q
    |||| || |||||| ||||| || ||||||||||||||||||||    
395710 gctcataacttcgcaataaaatccgcacaatgattaccctctct 395753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 208 - 296
Target Start/End: Complemental strand, 8533618 - 8533530
Alignment:
208 tcaacatctgttgtagctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttcttga 296  Q
    ||||||| ||||| |||| |||| |||||||||||||| ||||| || ||||||||| | |||||||||||||  ||||||||||||||    
8533618 tcaacatatgttgaagctgctagtttcgccataaagtccgcacattggttaccctctatgagcgagtgatgaagcgagtaatttcttga 8533530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 223 - 275
Target Start/End: Original strand, 55719679 - 55719731
Alignment:
223 gctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtg 275  Q
    ||||| ||||| ||||||||||||||||| || || ||||| |||||||||||    
55719679 gctccaagcttggccataaagtctgcacactggttgccctccctaagcgagtg 55719731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 174 - 296
Target Start/End: Complemental strand, 19860174 - 19860052
Alignment:
174 caggtcttcaggaagagatgagtagacagttaaatcaacatctgttgtagctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgag 273  Q
    ||||||||||||| |||| || | ||   |||| |||||| ||||||  |||||||| ||| | ||||| || ||| | || ||||||||||| ||||||    
19860174 caggtcttcaggaggagaagaatggatttttaattcaacacctgttgaggctcctagtttcacaataaaatccgcatattgcttaccctctctgagcgag 19860075  T
274 tgatgaatagagtaatttcttga 296  Q
    |||||||  ||| ||||||||||    
19860074 tgatgaagcgagaaatttcttga 19860052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 222 - 296
Target Start/End: Complemental strand, 27601439 - 27601365
Alignment:
222 agctcctagcttcgccataaagtctgcacaatgattaccctctctaagcgagtgatgaatagagtaatttcttga 296  Q
    |||||||||||| ||||| || || ||| | |||||||| |||||||||||| | |||| |||| ||||||||||    
27601439 agctcctagcttagccatgaaatccgcatactgattaccttctctaagcgagggctgaagagagaaatttcttga 27601365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 280
Target Start/End: Complemental strand, 14111 - 14066
Alignment:
235 gccataaagtctgcacaatgattaccctctctaagcgagtgatgaa 280  Q
    ||||||||||||||||| ||||| |||||||| || ||||||||||    
14111 gccataaagtctgcacactgatttccctctctgagtgagtgatgaa 14066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 248 - 296
Target Start/End: Complemental strand, 16700371 - 16700323
Alignment:
248 cacaatgattaccctctctaagcgagtgatgaatagagtaatttcttga 296  Q
    |||| |||||||| |||||||||||||| |||| |||| ||||||||||    
16700371 cacactgattaccttctctaagcgagtgctgaaaagagaaatttcttga 16700323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 314551 times since January 2019
Visitors: 446