View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_11_93 (Length: 677)

Name: J5_11_93
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_11_93
J5_11_93
[»] scaffold0431 (1 HSPs)
scaffold0431 (148-596)||(11174-11621)
[»] scaffold0028 (8 HSPs)
scaffold0028 (148-596)||(12259-12706)
scaffold0028 (148-596)||(21787-22234)
scaffold0028 (148-539)||(55868-56258)
scaffold0028 (148-198)||(47840-47890)
scaffold0028 (148-198)||(135731-135781)
scaffold0028 (148-198)||(138200-138250)
scaffold0028 (148-198)||(140669-140719)
scaffold0028 (148-198)||(143138-143188)
[»] chr2 (60 HSPs)
chr2 (148-596)||(24873338-24873784)
chr2 (148-577)||(23115642-23116072)
chr2 (148-564)||(27374710-27375125)
chr2 (148-564)||(24713475-24713890)
chr2 (148-550)||(16931962-16932362)
chr2 (148-550)||(17002455-17002855)
chr2 (148-564)||(24265811-24266225)
chr2 (148-522)||(41605671-41606043)
chr2 (148-564)||(10872291-10872705)
chr2 (148-550)||(16984695-16985095)
chr2 (148-564)||(22321930-22322344)
chr2 (152-564)||(44382160-44382572)
chr2 (148-550)||(9487671-9488072)
chr2 (148-550)||(9339037-9339438)
chr2 (148-539)||(22462064-22462455)
chr2 (148-497)||(24656241-24656591)
chr2 (148-564)||(23028046-23028461)
chr2 (148-489)||(22741550-22741891)
chr2 (148-564)||(21319587-21320002)
chr2 (148-564)||(20321424-20321846)
chr2 (148-564)||(24678931-24679346)
chr2 (148-496)||(23104316-23104659)
chr2 (148-481)||(23065901-23066233)
chr2 (148-481)||(23075351-23075683)
chr2 (148-562)||(24704092-24704479)
chr2 (148-481)||(22732360-22732691)
chr2 (264-496)||(23030272-23030504)
chr2 (148-229)||(27381727-27381808)
chr2 (315-496)||(24816590-24816771)
chr2 (148-225)||(24646324-24646401)
chr2 (290-363)||(23039346-23039419)
chr2 (148-198)||(6484399-6484449)
chr2 (148-198)||(12571700-12571750)
chr2 (148-198)||(12578182-12578232)
chr2 (148-198)||(21240351-21240401)
chr2 (148-198)||(23096592-23096642)
chr2 (148-198)||(23296862-23296912)
chr2 (148-198)||(27790297-27790347)
chr2 (148-198)||(31504972-31505022)
chr2 (148-199)||(19664421-19664472)
chr2 (148-198)||(19715588-19715638)
chr2 (148-198)||(19720151-19720201)
chr2 (148-198)||(24644140-24644190)
chr2 (148-198)||(28351698-28351748)
chr2 (264-496)||(21902048-21902280)
chr2 (148-204)||(23132389-23132445)
chr2 (148-204)||(23710593-23710649)
chr2 (148-204)||(24899264-24899320)
chr2 (148-204)||(24901741-24901797)
chr2 (148-204)||(24904218-24904274)
chr2 (148-204)||(24906693-24906749)
chr2 (151-198)||(1066294-1066341)
chr2 (148-183)||(20320332-20320367)
chr2 (151-198)||(20849410-20849457)
chr2 (262-325)||(23003763-23003826)
chr2 (151-198)||(31833201-31833248)
chr2 (148-196)||(19802971-19803019)
chr2 (148-196)||(19818620-19818668)
chr2 (148-204)||(26506903-26506959)
chr2 (148-196)||(45535315-45535363)
[»] chr5 (61 HSPs)
chr5 (152-564)||(22351661-22352072)
chr5 (148-564)||(29472303-29472717)
chr5 (148-564)||(27681630-27682044)
chr5 (148-564)||(22138410-22138824)
chr5 (148-564)||(27614098-27614513)
chr5 (148-564)||(19773702-19774117)
chr5 (148-550)||(22329105-22329517)
chr5 (148-564)||(41774585-41774999)
chr5 (148-564)||(27664733-27665147)
chr5 (148-564)||(37287727-37288140)
chr5 (148-550)||(16360258-16360659)
chr5 (148-550)||(34570250-34570648)
chr5 (148-550)||(40712536-40712936)
chr5 (148-549)||(14995981-14996368)
chr5 (189-550)||(27522162-27522522)
chr5 (148-562)||(18782861-18783275)
chr5 (148-485)||(23536441-23536778)
chr5 (149-568)||(21883518-21883936)
chr5 (148-562)||(20804344-20804762)
chr5 (148-564)||(23461649-23462057)
chr5 (148-481)||(25430247-25430580)
chr5 (148-310)||(41768264-41768425)
chr5 (149-460)||(26733722-26734032)
chr5 (262-487)||(21331329-21331554)
chr5 (263-496)||(23475006-23475239)
chr5 (418-496)||(23529086-23529164)
chr5 (151-198)||(22233418-22233465)
chr5 (148-198)||(16257248-16257298)
chr5 (148-198)||(17265545-17265595)
chr5 (148-198)||(22590967-22591017)
chr5 (148-198)||(22594522-22594572)
chr5 (148-198)||(23562384-23562434)
chr5 (148-198)||(43123571-43123621)
chr5 (1-38)||(1203315-1203352)
chr5 (151-198)||(20346389-20346436)
chr5 (148-199)||(22338176-22338227)
chr5 (151-198)||(24795905-24795952)
chr5 (151-198)||(25852180-25852227)
chr5 (148-198)||(316-366)
chr5 (148-198)||(21676339-21676389)
chr5 (148-198)||(23077132-23077182)
chr5 (148-202)||(24618514-24618568)
chr5 (148-202)||(24747773-24747827)
chr5 (148-196)||(6555111-6555159)
chr5 (264-460)||(21560370-21560566)
chr5 (148-204)||(21981810-21981865)
chr5 (148-196)||(30344073-30344121)
chr5 (151-198)||(22506774-22506821)
chr5 (148-179)||(23670760-23670791)
chr5 (151-194)||(37540876-37540919)
chr5 (148-178)||(20771256-20771286)
chr5 (148-178)||(20780031-20780061)
chr5 (148-178)||(20825574-20825604)
chr5 (148-202)||(24714745-24714799)
chr5 (148-178)||(28891162-28891192)
chr5 (148-177)||(20311820-20311849)
chr5 (151-179)||(14883205-14883233)
chr5 (148-196)||(16641826-16641874)
chr5 (148-176)||(22466070-22466098)
chr5 (148-204)||(29347507-29347563)
chr5 (148-204)||(29349980-29350036)
[»] scaffold0109 (2 HSPs)
scaffold0109 (148-596)||(41962-42409)
scaffold0109 (149-564)||(12179-12586)
[»] chr3 (97 HSPs)
chr3 (152-564)||(12890138-12890549)
chr3 (148-587)||(15398805-15399243)
chr3 (148-564)||(15359481-15359894)
chr3 (148-564)||(15712343-15712757)
chr3 (148-564)||(3689372-3689786)
chr3 (148-564)||(15344532-15344946)
chr3 (148-550)||(5421217-5421617)
chr3 (148-550)||(13249487-13249887)
chr3 (148-550)||(13256133-13256533)
chr3 (148-564)||(5107826-5108240)
chr3 (148-564)||(20058341-20058755)
chr3 (148-564)||(26789700-26790114)
chr3 (148-550)||(48428890-48429290)
chr3 (148-564)||(15585679-15586093)
chr3 (148-550)||(16639216-16639617)
chr3 (148-550)||(43166118-43166519)
chr3 (148-564)||(10009029-10009443)
chr3 (148-572)||(6597475-6597897)
chr3 (148-564)||(16752989-16753402)
chr3 (148-564)||(6604164-6604577)
chr3 (148-571)||(53381308-53381728)
chr3 (148-564)||(10909639-10910055)
chr3 (189-564)||(5109736-5110110)
chr3 (148-539)||(16695621-16696011)
chr3 (148-539)||(23414069-23414463)
chr3 (148-413)||(24186732-24186997)
chr3 (148-497)||(11861850-11862198)
chr3 (148-564)||(14872869-14873283)
chr3 (148-489)||(23078293-23078634)
chr3 (148-329)||(16490610-16490790)
chr3 (148-481)||(15458712-15459042)
chr3 (148-481)||(17498205-17498535)
chr3 (33-153)||(26709007-26709127)
chr3 (148-409)||(12502483-12502737)
chr3 (148-496)||(15066567-15066913)
chr3 (148-280)||(14125438-14125570)
chr3 (262-496)||(15263120-15263354)
chr3 (262-496)||(15263932-15264166)
chr3 (148-225)||(15966658-15966735)
chr3 (148-225)||(15970582-15970659)
chr3 (262-466)||(14577818-14578022)
chr3 (148-243)||(18437616-18437712)
chr3 (451-521)||(24186662-24186731)
chr3 (148-225)||(7111404-7111481)
chr3 (348-496)||(19728258-19728406)
chr3 (148-198)||(15937645-15937695)
chr3 (148-237)||(4109592-4109681)
chr3 (148-198)||(8743646-8743696)
chr3 (148-198)||(12356785-12356835)
chr3 (148-198)||(13945850-13945900)
chr3 (148-198)||(13969659-13969709)
chr3 (148-198)||(14089201-14089251)
chr3 (148-198)||(15935795-15935845)
chr3 (148-198)||(16383636-16383686)
chr3 (148-198)||(16824540-16824590)
chr3 (148-198)||(16830786-16830836)
chr3 (148-198)||(18130605-18130655)
chr3 (148-198)||(19445100-19445150)
chr3 (148-198)||(31691443-31691493)
chr3 (148-198)||(31942724-31942774)
chr3 (148-198)||(41180003-41180053)
chr3 (148-198)||(54974761-54974811)
chr3 (148-198)||(54977371-54977421)
chr3 (151-198)||(10409790-10409837)
chr3 (148-199)||(14577740-14577791)
chr3 (148-198)||(2036174-2036224)
chr3 (148-198)||(2039915-2039965)
chr3 (402-460)||(12842648-12842706)
chr3 (148-198)||(13314720-13314770)
chr3 (148-198)||(14040563-14040613)
chr3 (148-198)||(35983998-35984048)
chr3 (148-204)||(16455333-16455389)
chr3 (148-196)||(36526748-36526796)
chr3 (417-512)||(12857054-12857148)
chr3 (148-179)||(13027661-13027692)
chr3 (148-199)||(19728549-19728600)
chr3 (151-198)||(28758141-28758188)
chr3 (151-194)||(47127770-47127813)
chr3 (148-178)||(10416311-10416341)
chr3 (148-198)||(11957439-11957489)
chr3 (402-468)||(12508091-12508157)
chr3 (148-198)||(12856775-12856825)
chr3 (148-198)||(13304044-13304094)
chr3 (148-178)||(14289793-14289823)
chr3 (148-198)||(15011235-15011285)
chr3 (148-198)||(15231404-15231454)
chr3 (148-198)||(15237272-15237322)
chr3 (148-206)||(15263420-15263478)
chr3 (148-206)||(15264232-15264290)
chr3 (417-467)||(35983719-35983769)
chr3 (264-333)||(15231275-15231344)
chr3 (264-333)||(15237143-15237212)
chr3 (149-198)||(17190189-17190238)
chr3 (149-198)||(24191118-24191167)
chr3 (365-481)||(2245159-2245275)
chr3 (148-196)||(10953037-10953085)
chr3 (148-204)||(13152836-13152892)
[»] chr1 (47 HSPs)
chr1 (149-587)||(21843013-21843450)
chr1 (148-564)||(16346714-16347128)
chr1 (148-564)||(16353363-16353777)
chr1 (148-564)||(19110194-19110609)
chr1 (150-564)||(21834127-21834541)
chr1 (148-564)||(33387149-33387563)
chr1 (148-550)||(51329612-51330012)
chr1 (148-521)||(41349791-41350160)
chr1 (148-564)||(17041131-17041547)
chr1 (148-564)||(22832275-22832690)
chr1 (148-540)||(24783979-24784369)
chr1 (148-564)||(21177195-21177604)
chr1 (192-568)||(22459240-22459615)
chr1 (192-568)||(22469669-22470044)
chr1 (148-539)||(22434868-22435249)
chr1 (381-596)||(22401113-22401327)
chr1 (33-153)||(9791680-9791800)
chr1 (32-153)||(45995141-45995262)
chr1 (148-454)||(20247155-20247461)
chr1 (148-243)||(22359636-22359731)
chr1 (264-489)||(21044386-21044611)
chr1 (148-240)||(27251669-27251761)
chr1 (262-496)||(16379989-16380224)
chr1 (148-243)||(21753126-21753221)
chr1 (342-496)||(22117609-22117763)
chr1 (148-213)||(39245988-39246053)
chr1 (263-467)||(18273722-18273926)
chr1 (151-198)||(20073813-20073860)
chr1 (148-202)||(23196358-23196412)
chr1 (148-198)||(31536110-31536160)
chr1 (149-198)||(38908928-38908977)
chr1 (404-496)||(20922334-20922426)
chr1 (148-199)||(22117911-22117962)
chr1 (151-198)||(37681288-37681335)
chr1 (151-198)||(48427112-48427159)
chr1 (148-198)||(19858512-19858562)
chr1 (148-198)||(21738141-21738191)
chr1 (148-198)||(41311482-41311532)
chr1 (365-489)||(19858207-19858331)
chr1 (151-198)||(20298610-20298657)
chr1 (151-198)||(20397703-20397750)
chr1 (148-195)||(21044266-21044313)
chr1 (151-198)||(21962268-21962315)
chr1 (151-198)||(36212815-36212862)
chr1 (151-198)||(52989979-52990026)
chr1 (148-178)||(20046663-20046693)
chr1 (148-196)||(37192025-37192073)
[»] chr7 (61 HSPs)
chr7 (148-564)||(11233270-11233684)
chr7 (148-564)||(13689840-13690254)
chr7 (148-564)||(8711404-8711819)
chr7 (148-564)||(15157114-15157528)
chr7 (148-521)||(11549158-11549530)
chr7 (148-550)||(44787408-44787808)
chr7 (148-564)||(18586227-18586642)
chr7 (148-564)||(10874251-10874665)
chr7 (148-521)||(12691343-12691715)
chr7 (148-521)||(14958350-14958722)
chr7 (148-564)||(18181541-18181944)
chr7 (148-539)||(9592191-9592580)
chr7 (148-415)||(14336318-14336584)
chr7 (148-564)||(16725508-16725918)
chr7 (148-564)||(17702522-17702932)
chr7 (33-153)||(35926929-35927049)
chr7 (149-496)||(15144977-15145324)
chr7 (148-481)||(14043579-14043911)
chr7 (148-481)||(14353609-14353941)
chr7 (262-539)||(11526524-11526800)
chr7 (438-564)||(14336195-14336320)
chr7 (148-229)||(73141-73222)
chr7 (148-225)||(12716518-12716595)
chr7 (148-229)||(12721425-12721506)
chr7 (148-229)||(18281186-18281267)
chr7 (148-237)||(16115945-16116035)
chr7 (148-198)||(12460800-12460850)
chr7 (148-198)||(10306204-10306254)
chr7 (148-198)||(13677622-13677672)
chr7 (148-198)||(18049968-18050018)
chr7 (148-198)||(19615564-19615614)
chr7 (148-198)||(29798226-29798276)
chr7 (151-198)||(11300514-11300561)
chr7 (151-202)||(21756591-21756642)
chr7 (151-198)||(26090817-26090864)
chr7 (151-198)||(26114621-26114668)
chr7 (151-198)||(49156484-49156531)
chr7 (148-198)||(11311611-11311661)
chr7 (148-198)||(13025526-13025576)
chr7 (148-198)||(15098741-15098791)
chr7 (148-198)||(15811388-15811438)
chr7 (363-481)||(16946718-16946836)
chr7 (148-204)||(24703750-24703806)
chr7 (148-179)||(11384633-11384664)
chr7 (420-463)||(15115056-15115099)
chr7 (148-179)||(19151208-19151239)
chr7 (148-179)||(20750607-20750638)
chr7 (151-198)||(40923836-40923883)
chr7 (148-198)||(12202850-12202900)
chr7 (369-483)||(12801516-12801630)
chr7 (148-178)||(13005661-13005691)
chr7 (148-198)||(14145843-14145893)
chr7 (149-187)||(14220968-14221006)
chr7 (148-178)||(16928752-16928782)
chr7 (264-334)||(19151040-19151110)
chr7 (264-334)||(20750439-20750509)
chr7 (430-487)||(11984870-11984927)
chr7 (151-199)||(11769832-11769880)
chr7 (150-198)||(12693936-12693984)
chr7 (148-200)||(41524447-41524499)
chr7 (148-196)||(43746623-43746671)
[»] chr4 (45 HSPs)
chr4 (148-564)||(12480410-12480824)
chr4 (148-564)||(14299758-14300181)
chr4 (148-564)||(23959557-23959971)
chr4 (148-550)||(8390236-8390636)
chr4 (148-550)||(17090937-17091337)
chr4 (148-564)||(8049411-8049825)
chr4 (148-564)||(40476850-40477252)
chr4 (148-564)||(16232780-16233194)
chr4 (148-539)||(13514188-13514579)
chr4 (148-539)||(18223254-18223648)
chr4 (148-564)||(18603609-18604018)
chr4 (148-351)||(14684187-14684390)
chr4 (252-487)||(16247564-16247799)
chr4 (198-568)||(15143783-15144152)
chr4 (148-469)||(16240894-16241215)
chr4 (148-387)||(16349583-16349825)
chr4 (148-566)||(14822-15238)
chr4 (148-241)||(14306355-14306447)
chr4 (148-248)||(16244276-16244376)
chr4 (262-487)||(14163359-14163584)
chr4 (262-496)||(16220068-16220302)
chr4 (365-489)||(14700346-14700470)
chr4 (231-282)||(14306455-14306506)
chr4 (148-198)||(14992416-14992466)
chr4 (148-198)||(16151827-16151877)
chr4 (148-198)||(16155973-16156023)
chr4 (148-198)||(18270591-18270641)
chr4 (148-198)||(20894224-20894274)
chr4 (148-198)||(51602812-51602862)
chr4 (148-198)||(53749490-53749540)
chr4 (150-198)||(27904577-27904625)
chr4 (151-198)||(7358460-7358507)
chr4 (151-198)||(11203264-11203311)
chr4 (262-325)||(17332225-17332288)
chr4 (264-334)||(8709712-8709782)
chr4 (148-198)||(13742039-13742089)
chr4 (148-206)||(14187475-14187533)
chr4 (148-198)||(15074547-15074597)
chr4 (148-198)||(16229908-16229958)
chr4 (148-198)||(18260628-18260678)
chr4 (148-204)||(13880284-13880340)
chr4 (148-179)||(8709869-8709900)
chr4 (152-195)||(15267972-15268015)
chr4 (155-198)||(44657902-44657945)
chr4 (152-198)||(3260827-3260873)
[»] scaffold0029 (3 HSPs)
scaffold0029 (151-564)||(106828-107239)
scaffold0029 (148-496)||(9123-9470)
scaffold0029 (148-178)||(116190-116220)
[»] chr8 (54 HSPs)
chr8 (148-550)||(22116666-22117066)
chr8 (148-564)||(20014754-20015168)
chr8 (148-550)||(19116290-19116690)
chr8 (189-564)||(22125490-22125864)
chr8 (148-564)||(18860453-18860868)
chr8 (148-564)||(17670513-17670927)
chr8 (148-521)||(19480566-19480935)
chr8 (148-521)||(19497234-19497603)
chr8 (148-564)||(17829456-17829872)
chr8 (148-563)||(32604025-32604440)
chr8 (148-487)||(22043773-22044113)
chr8 (148-497)||(15537328-15537678)
chr8 (148-539)||(30309626-30310021)
chr8 (148-563)||(19981847-19982261)
chr8 (148-564)||(21163018-21163432)
chr8 (148-587)||(22113897-22114331)
chr8 (148-460)||(21390379-21390691)
chr8 (148-460)||(21779705-21780017)
chr8 (148-460)||(18880144-18880456)
chr8 (148-564)||(17354391-17354800)
chr8 (148-496)||(21672461-21672807)
chr8 (33-153)||(26767405-26767525)
chr8 (148-306)||(23777784-23777942)
chr8 (148-481)||(6518331-6518662)
chr8 (148-460)||(22420375-22420692)
chr8 (148-241)||(21919880-21919973)
chr8 (148-229)||(21974921-21975002)
chr8 (262-460)||(22524395-22524593)
chr8 (404-487)||(22994633-22994716)
chr8 (147-198)||(21929682-21929733)
chr8 (148-198)||(21323030-21323080)
chr8 (148-198)||(21981444-21981494)
chr8 (148-198)||(21986363-21986413)
chr8 (148-198)||(31568571-31568621)
chr8 (264-357)||(20392171-20392264)
chr8 (149-198)||(21968605-21968654)
chr8 (369-481)||(21330530-21330642)
chr8 (151-198)||(16267699-16267746)
chr8 (148-199)||(22524660-22524711)
chr8 (148-198)||(19986383-19986433)
chr8 (148-198)||(22003571-22003621)
chr8 (148-198)||(22026754-22026804)
chr8 (148-198)||(22176748-22176798)
chr8 (148-198)||(29299899-29299949)
chr8 (151-194)||(28985173-28985216)
chr8 (148-179)||(44478317-44478348)
chr8 (148-178)||(22049623-22049653)
chr8 (148-178)||(22055141-22055171)
chr8 (405-467)||(22242174-22242236)
chr8 (148-198)||(31413086-31413136)
chr8 (148-177)||(22709756-22709785)
chr8 (148-196)||(19806766-19806814)
chr8 (148-180)||(22176672-22176704)
chr8 (365-481)||(31413305-31413421)
[»] chr6 (51 HSPs)
chr6 (148-572)||(24291973-24292397)
chr6 (148-564)||(2870995-2871409)
chr6 (148-522)||(25116276-25116648)
chr6 (148-564)||(16575564-16575979)
chr6 (148-564)||(16619401-16619816)
chr6 (148-564)||(28259392-28259804)
chr6 (148-564)||(28286112-28286524)
chr6 (148-564)||(28338141-28338553)
chr6 (148-550)||(29588631-29589032)
chr6 (148-564)||(28313304-28313716)
chr6 (148-564)||(27206296-27206708)
chr6 (148-564)||(27242520-27242932)
chr6 (148-562)||(5835421-5835833)
chr6 (150-562)||(21765491-21765902)
chr6 (148-387)||(27554483-27554723)
chr6 (148-496)||(22437613-22437955)
chr6 (148-424)||(19872004-19872280)
chr6 (268-539)||(25755919-25756189)
chr6 (148-481)||(18404125-18404458)
chr6 (262-484)||(23082179-23082401)
chr6 (148-328)||(25607415-25607601)
chr6 (446-564)||(22828876-22828993)
chr6 (396-539)||(27558253-27558395)
chr6 (149-328)||(19667346-19667524)
chr6 (315-496)||(23084181-23084362)
chr6 (148-234)||(16960965-16961051)
chr6 (420-496)||(18181848-18181924)
chr6 (264-489)||(25958058-25958283)
chr6 (396-496)||(19667190-19667290)
chr6 (148-198)||(8719884-8719934)
chr6 (148-198)||(8761207-8761257)
chr6 (148-198)||(10465033-10465083)
chr6 (148-198)||(21475594-21475644)
chr6 (148-237)||(22950843-22950932)
chr6 (148-237)||(23873287-23873376)
chr6 (402-489)||(21475284-21475371)
chr6 (148-198)||(5295388-5295438)
chr6 (148-198)||(16828760-16828810)
chr6 (148-198)||(18798740-18798790)
chr6 (148-198)||(19457016-19457066)
chr6 (148-198)||(19467161-19467211)
chr6 (438-496)||(19868362-19868420)
chr6 (148-204)||(33863323-33863379)
chr6 (148-178)||(15463404-15463434)
chr6 (148-237)||(19004058-19004147)
chr6 (148-198)||(25771900-25771950)
chr6 (148-178)||(34641768-34641798)
chr6 (262-351)||(18178748-18178837)
chr6 (148-176)||(18318399-18318427)
chr6 (148-196)||(18451212-18451260)
chr6 (150-178)||(20009686-20009714)
[»] scaffold0008 (3 HSPs)
scaffold0008 (148-564)||(691-1107)
scaffold0008 (148-539)||(138645-139036)
scaffold0008 (148-460)||(15661-15971)
[»] scaffold0403 (2 HSPs)
scaffold0403 (148-487)||(486-832)
scaffold0403 (148-460)||(15856-16168)
[»] scaffold0010 (5 HSPs)
scaffold0010 (148-539)||(22055-22446)
scaffold0010 (148-484)||(15345-15682)
scaffold0010 (263-496)||(5824-6057)
scaffold0010 (148-198)||(38368-38418)
scaffold0010 (148-178)||(179879-179909)
[»] scaffold0003 (2 HSPs)
scaffold0003 (252-587)||(425117-425452)
scaffold0003 (148-539)||(138553-138944)
[»] scaffold0044 (3 HSPs)
scaffold0044 (148-487)||(18078-18417)
scaffold0044 (148-477)||(6920-7221)
scaffold0044 (473-564)||(4263-4353)
[»] scaffold0451 (1 HSPs)
scaffold0451 (148-487)||(13070-13416)
[»] scaffold0305 (1 HSPs)
scaffold0305 (148-480)||(3780-4112)
[»] scaffold0017 (5 HSPs)
scaffold0017 (148-562)||(16113-16526)
scaffold0017 (148-562)||(20635-21048)
scaffold0017 (147-489)||(193914-194256)
scaffold0017 (148-198)||(3487-3537)
scaffold0017 (365-483)||(3718-3836)
[»] scaffold0009 (2 HSPs)
scaffold0009 (148-487)||(228898-229238)
scaffold0009 (148-198)||(252841-252891)
[»] scaffold1220 (1 HSPs)
scaffold1220 (148-562)||(580-993)
[»] scaffold0393 (1 HSPs)
scaffold0393 (148-562)||(275-691)
[»] scaffold0718 (1 HSPs)
scaffold0718 (148-564)||(6049-6464)
[»] scaffold0280 (1 HSPs)
scaffold0280 (148-549)||(23274-23673)
[»] scaffold0042 (2 HSPs)
scaffold0042 (149-564)||(35868-36282)
scaffold0042 (402-466)||(27291-27355)
[»] scaffold1459 (1 HSPs)
scaffold1459 (148-562)||(140-552)
[»] scaffold0081 (2 HSPs)
scaffold0081 (148-564)||(37870-38286)
scaffold0081 (148-564)||(22446-22862)
[»] scaffold0412 (1 HSPs)
scaffold0412 (148-521)||(14635-15007)
[»] scaffold0410 (2 HSPs)
scaffold0410 (148-487)||(1059-1386)
scaffold0410 (148-189)||(11269-11310)
[»] scaffold0261 (5 HSPs)
scaffold0261 (148-563)||(82-496)
scaffold0261 (151-198)||(11450-11497)
scaffold0261 (151-198)||(19630-19677)
scaffold0261 (365-489)||(11678-11802)
scaffold0261 (365-489)||(19858-19982)
[»] scaffold0080 (4 HSPs)
scaffold0080 (148-539)||(32746-33136)
scaffold0080 (148-420)||(9330-9597)
scaffold0080 (148-454)||(20770-21075)
scaffold0080 (322-564)||(55479-55721)
[»] scaffold0177 (1 HSPs)
scaffold0177 (148-562)||(14095-14501)
[»] scaffold0490 (4 HSPs)
scaffold0490 (148-460)||(836-1149)
scaffold0490 (148-198)||(4053-4103)
scaffold0490 (264-334)||(3904-3974)
scaffold0490 (417-489)||(3781-3853)
[»] scaffold0064 (1 HSPs)
scaffold0064 (148-564)||(65577-65992)
[»] scaffold0656 (1 HSPs)
scaffold0656 (148-564)||(149-559)
[»] scaffold0501 (1 HSPs)
scaffold0501 (148-496)||(751-1099)
[»] scaffold0198 (1 HSPs)
scaffold0198 (148-496)||(31196-31543)
[»] scaffold0289 (1 HSPs)
scaffold0289 (148-562)||(632-1038)
[»] scaffold0540 (1 HSPs)
scaffold0540 (152-481)||(9931-10260)
[»] scaffold0273 (2 HSPs)
scaffold0273 (148-453)||(9376-9681)
scaffold0273 (396-568)||(869-1040)
[»] scaffold0423 (1 HSPs)
scaffold0423 (148-460)||(679-991)
[»] scaffold0034 (3 HSPs)
scaffold0034 (262-539)||(121329-121605)
scaffold0034 (148-198)||(71594-71644)
scaffold0034 (405-489)||(1255-1339)
[»] scaffold0546 (1 HSPs)
scaffold0546 (149-564)||(721-1128)
[»] scaffold0358 (1 HSPs)
scaffold0358 (147-481)||(9871-10205)
[»] scaffold0090 (2 HSPs)
scaffold0090 (148-481)||(30046-30379)
scaffold0090 (148-359)||(1779-1994)
[»] scaffold0120 (2 HSPs)
scaffold0120 (148-481)||(15008-15341)
scaffold0120 (156-481)||(12187-12510)
[»] scaffold0071 (1 HSPs)
scaffold0071 (148-481)||(3149-3479)
[»] scaffold0022 (3 HSPs)
scaffold0022 (198-568)||(33869-34238)
scaffold0022 (148-481)||(42556-42884)
scaffold0022 (148-481)||(76276-76604)
[»] scaffold0007 (3 HSPs)
scaffold0007 (284-539)||(49529-49783)
scaffold0007 (148-232)||(49785-49869)
scaffold0007 (148-196)||(83729-83777)
[»] scaffold0297 (2 HSPs)
scaffold0297 (148-496)||(11477-11819)
scaffold0297 (402-539)||(6958-7094)
[»] scaffold0114 (2 HSPs)
scaffold0114 (149-481)||(16397-16729)
scaffold0114 (148-198)||(41280-41330)
[»] scaffold0079 (1 HSPs)
scaffold0079 (148-387)||(37456-37698)
[»] scaffold0055 (1 HSPs)
scaffold0055 (332-564)||(23086-23317)
[»] scaffold0052 (1 HSPs)
scaffold0052 (332-564)||(8075-8306)
[»] scaffold0102 (1 HSPs)
scaffold0102 (148-489)||(49392-49733)
[»] scaffold0411 (1 HSPs)
scaffold0411 (152-460)||(9356-9668)
[»] scaffold0819 (1 HSPs)
scaffold0819 (148-496)||(1012-1354)
[»] scaffold0019 (1 HSPs)
scaffold0019 (284-539)||(171986-172240)
[»] scaffold0181 (1 HSPs)
scaffold0181 (148-345)||(28047-28235)
[»] scaffold0103 (1 HSPs)
scaffold0103 (148-274)||(17912-18037)
[»] scaffold0122 (2 HSPs)
scaffold0122 (148-469)||(39644-39965)
scaffold0122 (148-243)||(22572-22666)
[»] scaffold0324 (1 HSPs)
scaffold0324 (190-481)||(2636-2924)
[»] scaffold0420 (1 HSPs)
scaffold0420 (148-481)||(7200-7532)
[»] scaffold0789 (1 HSPs)
scaffold0789 (433-596)||(734-896)
[»] scaffold0084 (1 HSPs)
scaffold0084 (148-460)||(9168-9480)
[»] scaffold0285 (1 HSPs)
scaffold0285 (324-539)||(5865-6078)
[»] scaffold0218 (1 HSPs)
scaffold0218 (279-481)||(23904-24106)
[»] scaffold0130 (2 HSPs)
scaffold0130 (343-563)||(7021-7240)
scaffold0130 (148-282)||(6881-7023)
[»] scaffold0075 (1 HSPs)
scaffold0075 (148-496)||(54520-54867)
[»] scaffold0023 (4 HSPs)
scaffold0023 (148-323)||(29673-29848)
scaffold0023 (264-481)||(41174-41391)
scaffold0023 (396-564)||(29869-30036)
scaffold0023 (149-243)||(41056-41149)
[»] scaffold0077 (3 HSPs)
scaffold0077 (262-496)||(56816-57050)
scaffold0077 (148-198)||(18949-18999)
scaffold0077 (148-198)||(56697-56747)
[»] scaffold0278 (1 HSPs)
scaffold0278 (148-481)||(4475-4806)
[»] scaffold0207 (2 HSPs)
scaffold0207 (148-460)||(3596-3906)
scaffold0207 (148-196)||(12544-12592)
[»] scaffold2059 (1 HSPs)
scaffold2059 (342-564)||(11-231)
[»] scaffold0621 (2 HSPs)
scaffold0621 (148-481)||(941-1272)
scaffold0621 (148-481)||(5358-5689)
[»] scaffold0574 (1 HSPs)
scaffold0574 (148-240)||(8762-8854)
[»] scaffold0647 (1 HSPs)
scaffold0647 (148-243)||(6995-7090)
[»] scaffold0235 (1 HSPs)
scaffold0235 (148-243)||(12370-12465)
[»] scaffold0006 (2 HSPs)
scaffold0006 (262-497)||(105103-105338)
scaffold0006 (148-200)||(105401-105453)
[»] scaffold0447 (2 HSPs)
scaffold0447 (262-496)||(1174-1408)
scaffold0447 (148-199)||(1050-1101)
[»] scaffold0383 (2 HSPs)
scaffold0383 (262-496)||(4038-4272)
scaffold0383 (148-199)||(3914-3965)
[»] scaffold0282 (1 HSPs)
scaffold0282 (262-487)||(12759-12984)
[»] scaffold0357 (1 HSPs)
scaffold0357 (148-496)||(17026-17372)
[»] scaffold0040 (3 HSPs)
scaffold0040 (148-361)||(104603-104820)
scaffold0040 (315-413)||(21125-21223)
scaffold0040 (420-460)||(18790-18830)
[»] scaffold0293 (3 HSPs)
scaffold0293 (262-484)||(16331-16553)
scaffold0293 (306-496)||(9239-9429)
scaffold0293 (148-204)||(16621-16677)
[»] scaffold0342 (1 HSPs)
scaffold0342 (316-487)||(13480-13651)
[»] scaffold0018 (1 HSPs)
scaffold0018 (315-496)||(8564-8745)
[»] scaffold0556 (1 HSPs)
scaffold0556 (148-302)||(5836-5990)
[»] scaffold0228 (1 HSPs)
scaffold0228 (148-241)||(21116-21207)
[»] scaffold0001 (5 HSPs)
scaffold0001 (315-477)||(442580-442742)
scaffold0001 (148-198)||(452528-452578)
scaffold0001 (148-179)||(442883-442914)
scaffold0001 (151-198)||(513388-513435)
scaffold0001 (155-199)||(164194-164238)
[»] scaffold0243 (3 HSPs)
scaffold0243 (226-334)||(23321-23429)
scaffold0243 (148-198)||(8809-8859)
scaffold0243 (148-212)||(11061-11124)
[»] scaffold0169 (1 HSPs)
scaffold0169 (366-478)||(35480-35592)
[»] scaffold0074 (2 HSPs)
scaffold0074 (346-485)||(7031-7170)
scaffold0074 (148-200)||(7309-7361)
[»] scaffold0476 (1 HSPs)
scaffold0476 (221-454)||(11717-11949)
[»] scaffold0011 (2 HSPs)
scaffold0011 (262-487)||(22694-22919)
scaffold0011 (148-199)||(22576-22627)
[»] scaffold0309 (1 HSPs)
scaffold0309 (315-422)||(20079-20186)
[»] scaffold1274 (2 HSPs)
scaffold1274 (365-487)||(535-657)
scaffold1274 (148-200)||(821-873)
[»] scaffold0672 (1 HSPs)
scaffold0672 (342-400)||(1-59)
[»] scaffold1845 (1 HSPs)
scaffold1845 (148-198)||(336-386)
[»] scaffold1600 (2 HSPs)
scaffold1600 (148-198)||(1262-1312)
scaffold1600 (402-496)||(966-1060)
[»] scaffold1426 (1 HSPs)
scaffold1426 (152-198)||(679-725)
[»] scaffold1061 (1 HSPs)
scaffold1061 (148-198)||(626-676)
[»] scaffold0765 (1 HSPs)
scaffold0765 (148-198)||(5315-5365)
[»] scaffold0586 (1 HSPs)
scaffold0586 (148-198)||(781-831)
[»] scaffold0348 (1 HSPs)
scaffold0348 (148-198)||(16241-16291)
[»] scaffold0317 (1 HSPs)
scaffold0317 (148-198)||(3841-3891)
[»] scaffold0190 (1 HSPs)
scaffold0190 (148-198)||(21328-21378)
[»] scaffold0188 (1 HSPs)
scaffold0188 (148-198)||(32405-32455)
[»] scaffold0138 (1 HSPs)
scaffold0138 (148-198)||(293-343)
[»] scaffold0124 (1 HSPs)
scaffold0124 (148-198)||(15147-15197)
[»] scaffold0098 (1 HSPs)
scaffold0098 (148-198)||(26681-26731)
[»] scaffold0067 (5 HSPs)
scaffold0067 (148-198)||(30845-30895)
scaffold0067 (148-198)||(48214-48264)
scaffold0067 (148-198)||(57248-57298)
scaffold0067 (148-198)||(63634-63684)
scaffold0067 (365-481)||(30548-30664)
[»] scaffold0065 (1 HSPs)
scaffold0065 (148-198)||(28557-28607)
[»] scaffold0054 (1 HSPs)
scaffold0054 (148-198)||(62575-62625)
[»] scaffold0049 (1 HSPs)
scaffold0049 (148-198)||(43747-43797)
[»] scaffold0046 (4 HSPs)
scaffold0046 (148-198)||(71325-71375)
scaffold0046 (417-496)||(71017-71096)
scaffold0046 (148-179)||(79157-79188)
scaffold0046 (342-488)||(846-992)
[»] scaffold0031 (1 HSPs)
scaffold0031 (148-198)||(116845-116895)
[»] scaffold0026 (1 HSPs)
scaffold0026 (148-198)||(52870-52920)
[»] scaffold0331 (1 HSPs)
scaffold0331 (315-496)||(14217-14398)
[»] scaffold0180 (1 HSPs)
scaffold0180 (264-357)||(30223-30316)
[»] scaffold0004 (2 HSPs)
scaffold0004 (148-197)||(320417-320466)
scaffold0004 (291-340)||(320305-320354)
[»] scaffold0544 (1 HSPs)
scaffold0544 (148-199)||(859-910)
[»] scaffold0457 (1 HSPs)
scaffold0457 (151-198)||(13090-13137)
[»] scaffold0118 (1 HSPs)
scaffold0118 (151-198)||(1683-1730)
[»] scaffold0088 (1 HSPs)
scaffold0088 (151-198)||(31132-31179)
[»] scaffold1433 (1 HSPs)
scaffold1433 (148-198)||(354-404)
[»] scaffold1257 (1 HSPs)
scaffold1257 (148-198)||(22-72)
[»] scaffold1056 (1 HSPs)
scaffold1056 (148-198)||(2933-2983)
[»] scaffold0679 (1 HSPs)
scaffold0679 (148-198)||(66-116)
[»] scaffold0434 (1 HSPs)
scaffold0434 (148-198)||(4937-4987)
[»] scaffold0310 (1 HSPs)
scaffold0310 (148-198)||(12199-12249)
[»] scaffold0222 (2 HSPs)
scaffold0222 (148-198)||(21987-22037)
scaffold0222 (405-489)||(21682-21766)
[»] scaffold0203 (1 HSPs)
scaffold0203 (148-198)||(3117-3167)
[»] scaffold0165 (1 HSPs)
scaffold0165 (148-194)||(17156-17202)
[»] scaffold0106 (1 HSPs)
scaffold0106 (148-198)||(35538-35588)
[»] scaffold0104 (4 HSPs)
scaffold0104 (417-467)||(42735-42785)
scaffold0104 (149-183)||(15593-15627)
scaffold0104 (149-183)||(17613-17647)
scaffold0104 (148-198)||(42456-42506)
[»] scaffold0076 (1 HSPs)
scaffold0076 (148-198)||(31003-31053)
[»] scaffold0072 (1 HSPs)
scaffold0072 (148-198)||(55267-55317)
[»] scaffold0069 (2 HSPs)
scaffold0069 (148-198)||(33779-33829)
scaffold0069 (264-357)||(33607-33700)
[»] scaffold0068 (1 HSPs)
scaffold0068 (148-198)||(66140-66190)
[»] scaffold0053 (1 HSPs)
scaffold0053 (148-198)||(61807-61857)
[»] scaffold0020 (1 HSPs)
scaffold0020 (148-198)||(177195-177245)
[»] scaffold0016 (1 HSPs)
scaffold0016 (148-198)||(175676-175726)
[»] scaffold0005 (1 HSPs)
scaffold0005 (148-194)||(264454-264500)
[»] scaffold0848 (2 HSPs)
scaffold0848 (420-481)||(4330-4391)
scaffold0848 (148-198)||(4067-4117)
[»] scaffold0553 (1 HSPs)
scaffold0553 (150-199)||(9531-9580)
[»] scaffold0395 (2 HSPs)
scaffold0395 (148-241)||(15593-15685)
scaffold0395 (262-310)||(15711-15759)
[»] scaffold0254 (1 HSPs)
scaffold0254 (148-204)||(19791-19847)
[»] scaffold0111 (1 HSPs)
scaffold0111 (148-196)||(6209-6257)
[»] scaffold0609 (1 HSPs)
scaffold0609 (264-467)||(8495-8698)
[»] scaffold0443 (1 HSPs)
scaffold0443 (151-198)||(12626-12673)
[»] scaffold0429 (1 HSPs)
scaffold0429 (402-457)||(723-778)
[»] scaffold0301 (1 HSPs)
scaffold0301 (149-196)||(1313-1360)
[»] scaffold0259 (1 HSPs)
scaffold0259 (462-564)||(9097-9197)
[»] scaffold0167 (1 HSPs)
scaffold0167 (148-195)||(6277-6324)
[»] scaffold0151 (1 HSPs)
scaffold0151 (148-199)||(1184-1235)
[»] scaffold0148 (1 HSPs)
scaffold0148 (415-486)||(6990-7061)
[»] scaffold1299 (1 HSPs)
scaffold1299 (148-198)||(880-930)
[»] scaffold0751 (2 HSPs)
scaffold0751 (417-467)||(6118-6168)
scaffold0751 (148-196)||(6397-6445)
[»] scaffold0671 (1 HSPs)
scaffold0671 (369-451)||(3886-3968)
[»] scaffold0379 (1 HSPs)
scaffold0379 (148-198)||(5221-5271)
[»] scaffold0304 (1 HSPs)
scaffold0304 (148-198)||(800-850)
[»] scaffold0192 (1 HSPs)
scaffold0192 (148-198)||(30731-30781)
[»] scaffold0139 (1 HSPs)
scaffold0139 (148-194)||(16835-16881)
[»] scaffold0085 (1 HSPs)
scaffold0085 (148-178)||(17168-17198)
[»] scaffold0058 (2 HSPs)
scaffold0058 (148-178)||(16656-16686)
scaffold0058 (148-198)||(23342-23392)
[»] scaffold1336 (1 HSPs)
scaffold1336 (148-177)||(1622-1651)
[»] scaffold0664 (1 HSPs)
scaffold0664 (148-177)||(699-728)
[»] scaffold0156 (1 HSPs)
scaffold0156 (405-478)||(37865-37938)
[»] scaffold1256 (1 HSPs)
scaffold1256 (148-196)||(1332-1380)
[»] scaffold0947 (1 HSPs)
scaffold0947 (148-196)||(582-630)
[»] scaffold0439 (1 HSPs)
scaffold0439 (148-196)||(13005-13053)
[»] scaffold0371 (1 HSPs)
scaffold0371 (148-204)||(4604-4659)
[»] scaffold0220 (1 HSPs)
scaffold0220 (148-196)||(14718-14766)
[»] scaffold0149 (1 HSPs)
scaffold0149 (148-204)||(28816-28871)
[»] scaffold0113 (1 HSPs)
scaffold0113 (154-198)||(18449-18493)
[»] scaffold0061 (1 HSPs)
scaffold0061 (148-196)||(20650-20698)


Alignment Details
Target: scaffold0431 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: scaffold0431
Description:

Target: scaffold0431; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 148 - 596
Target Start/End: Complemental strand, 11621 - 11174
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
11621 caattggtatcagagcaggtcggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattaccatcttatgttgttgttgctactt 11522  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||  ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
11521 ttatagaatatcaggaatggctggaagaaacgatgctgcgttagctgctgcactacaagctgttgcccaagctgtgggacaataacctaacgcaaatgct 11422  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||    
11421 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctccaactttcaaaggaagatatgaccctgatggagcccagacgtggctta 11322  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||| |||||||| || | |||||||||||| || |||    
11321 aagagattgagaggattttccgtgttatgcagtgcactgaagatcag-aaagtacggtttggtactcatcagctagctgaggaagctgatgactggtggg 11223  T
548 ttggncttctaccta-ccttgggcaaaaaggncctgttgtggacctgggc 596  Q
    |||| |||||||||| |||||||||| ||||  ||||||| |||||||||    
11222 ttggccttctacctacccttgggcaagaaggagctgttgt-gacctgggc 11174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028 (Bit Score: 347; Significance: 0; HSPs: 8)
Name: scaffold0028
Description:

Target: scaffold0028; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 148 - 596
Target Start/End: Complemental strand, 12706 - 12259
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12706 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 12607  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
12606 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcctaagctgtgggacaacaacctaacgcaaatgct 12507  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||    
12506 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctccaactttcaaaggaagatatgaccctgatggagcccagacgtggctta 12407  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    ||||||||||||||||||||||||||||| |||||||||| |||||| ||||||| | ||| |||| |||||||| || | |||| ||||||| || |||    
12406 aagagattgagaggattttccgtgttatgtagtgcactgaggatcag-aaagtgcagtttgatactcatcagctagctgaggaagttgatgactggtggg 12308  T
548 ttggncttctaccta-ccttgggcaaaaaggncctgttgtggacctgggc 596  Q
    |||| |||||||||| || ||||||| ||||  ||||||| |||||||||    
12307 ttggccttctacctacccatgggcaagaaggagctgttgt-gacctgggc 12259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028; HSP #2
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 148 - 596
Target Start/End: Complemental strand, 22234 - 21787
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22234 caattggtatcatagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 22135  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
22134 ttgaagaatatcaggaatggctggaagaaatgatgatgcgttagctgctgcactacaagttgttgcccaagctgtgggacaacaacctaacgcaaatgct 22035  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||| ||||||||||    
22034 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctccaactttcaaaggaagatatgaccctgatcgagcccagacgtggctta 21935  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    |||||||||||||||||||||||||||||||||||||||| |||||| ||||||| | |||||||| |||||||| || | |||| ||||||| || |||    
21934 aagagattgagaggattttccgtgttatgcagtgcactgaggatcag-aaagtgcagtttggtactcatcagctagctgaggaagttgatgactggtggg 21836  T
548 ttggncttctaccta-ccttgggcaaaaaggncctgttgtggacctgggc 596  Q
    |||| |||||||||| |||||||||| ||||  ||||||| |||||||||    
21835 ttggccttctacctacccttgggcaagaaggagctgttgt-gacctgggc 21787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028; HSP #3
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 148 - 539
Target Start/End: Complemental strand, 56258 - 55868
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
56258 caattggtatcagagcaggtcggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgatactt 56159  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| ||||| |||| |||||||||||||||||||| |||||||||||||||  |||||||||||||||||||||||||||||||||| ||||| ||||||    
56158 ttgtagaatctcagtaatggctggaagaaacgatgttgcgttagctgctgctttacaagctgttgcccaagctgtgggacaacaacccaacgcgaatgct 56059  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||| ||||||||||  ||||||||||||||||||  || |||||||||||| || ||||| ||  |||||||||| ||||||||||| ||||||||||    
56058 ggtgcaaatgctgagatgaggatgttggagactttctcgaggaagaaccctccaaccttcaaggggagatatgacccggatggagcccagacgtggctta 55959  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatga 539  Q
    ||||||| |||||||| |||||||| |||||||||||||| |||||| ||||||||  | |||||| |||||||| || | |||||||||||    
55958 aagagatagagaggatcttccgtgtgatgcagtgcactgaggatcag-aaagtgcgattcggtactcatcagctagctgaggaagctgatga 55868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028; HSP #4
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 198
Target Start/End: Original strand, 47840 - 47890
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||||||||||||||| ||| ||| ||||||||||    
47840 caattggtatcagagcaggttggtccgtccggccaagtagtagagtcgtgt 47890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028; HSP #5
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 135781 - 135731
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||| ||||||||||| ||| |||  |||||||||    
135781 caattggtatcagagcaggtcggtccgtccggccaagtagttgagtcgtgt 135731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028; HSP #6
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 138250 - 138200
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||| ||||||||||| ||| |||  |||||||||    
138250 caattggtatcagagcaggtcggtccgtccggccaagtagttgagtcgtgt 138200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028; HSP #7
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 140719 - 140669
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||| ||||||||||| ||| |||  |||||||||    
140719 caattggtatcagagcaggtcggtccgtccggccaagtagttgagtcgtgt 140669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028; HSP #8
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 143188 - 143138
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||| ||||||||||| ||| |||  |||||||||    
143188 caattggtatcagagcaggtcggtccgtccggccaagtagttgagtcgtgt 143138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 339; Significance: 0; HSPs: 60)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 148 - 596
Target Start/End: Original strand, 24873338 - 24873784
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
24873338 caattggtatcagagcaggtcggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgcttctt 24873437  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| |||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
24873438 ttgtagaatatcaggaatggctggaagaaatgatgttgcgttagctgctgcactacaagctgtt-cccaagctgtgggacaacaacctaacgcaaatgct 24873536  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    |||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||    
24873537 ggtgcgaatgctgagactaggatgttggagactttcatgaataagaaccctccaactttcaaaggaagatatgaccctgatggagcccagacgtggctta 24873636  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |||||||| || | |||||||||||| || |||    
24873637 aagagattgagaggattttccgtgttatgcagtgcactgaagatcag-aaagtgcggtttggtactcatcagctagctgaggaagctgatgactggtggg 24873735  T
548 ttggncttctaccta-ccttgggcaaaaaggncctgttgtggacctgggc 596  Q
    |||| |||||||||| |||||||||| ||||  ||||||| |||||||||    
24873736 ttggccttctacctacccttgggcaagaaggagctgttgt-gacctgggc 24873784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 148 - 577
Target Start/End: Original strand, 23115642 - 23116072
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||| ||||    
23115642 caattggtatcatagcaggtcggtccgtccggtcaattagaagagtcttgtcgagtcttagtaatttttgtattactatcttatgttgttgttgcaactt 23115741  T
248 -ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgc 346  Q
     ||| |||||||||| |||||||||||| ||||||| ||||||||||| ||| ||||||||| |||||||||||||||||||||||||||| ||| ||||    
23115742 gttgtagaatatcagcaatggctggaaggaacgatgctgcgttagctgttgctctacaagctattgcccaagctgtgggacaacaacctaatgcagatgc 23115841  T
347 tggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctt 446  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||    
23115842 tggtgcgaatgctgagacgaggatgttggagactttcatgaagaagaaccctccaactttcaaaggaagatatgaccctgatggagcccagacgtggctt 23115941  T
447 aaagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccggggg 546  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||| |||||||| || | |||||||||||| || ||    
23115942 aaagagattgagaggatcttccgtgttatgcagtgcactgaagatcag-aaagtgcggtttggtactcatcagctagctgaggaagctgatgactggtgg 23116040  T
547 gttggncttctaccta-ccttgggcaaaaagg 577  Q
    ||| | |||||||||| |||||||||| ||||    
23116041 gttagccttctacctacccttgggcaagaagg 23116072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 148 - 564
Target Start/End: Complemental strand, 27375125 - 27374710
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
27375125 caattggtatcagagcaggttgatccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttattgctactt 27375026  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| ||||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||  ||||||    
27375025 ttgtagaatatcaggaatggctggaagaaacgatgttgcgtcagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgtgaatgct 27374926  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||| ||||||||   ||||||||||||||| |||||||||||||||||||| ||||||| |||||| |||||||||||||||||||| ||||||||||    
27374925 ggtgcaaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcagaggacgttatgaccctgatggagcccagacgtggctta 27374826  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| |||||||||||||| || |||||| ||||||||| |||||||| |||||||  |  | |||||||||||| || |||    
27374825 aggagattgagaggattttccgggttatgcagtgcacggaggatcag-aaagtgcggtttggtactcatcagctggccgaggaagctgatgactggtggg 27374727  T
548 ttggncttctacctacc 564  Q
    |||  ||||||||||||    
27374726 ttgctcttctacctacc 27374710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 148 - 564
Target Start/End: Complemental strand, 24713890 - 24713475
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24713890 caattggtatcagagcaggtcggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 24713791  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| ||||| || | |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||    
24713790 ttgtagaatctcggaaatggctggaagaaacgatgctgcgttagctgctgctctacaagctgttgcccaagctgtcggacaacaacctaacgcaaatgct 24713691  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    |||||||| || ||   ||||||||||||||| |||||||||||||||||||| ||||||| |||||| |||||||||||||||||||| ||||||||||    
24713690 ggtgcgaacgcggaagctaggatgttggagacgttcatgaagaagaaccctccgactttcagaggacgttatgaccctgatggagcccagacgtggctta 24713591  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| |||||||||||||| || |||||| ||||||||  |||||||| |||||||  |  | |||||||||||| || |||    
24713590 aggagattgagaggattttccgggttatgcagtgcacggaggatcag-aaagtgcgatttggtactcatcagctggccgaggaagctgatgactggtggg 24713492  T
548 ttggncttctacctacc 564  Q
    |||  ||||| ||||||    
24713491 ttgctcttctgcctacc 24713475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 148 - 550
Target Start/End: Complemental strand, 16932362 - 16931962
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
16932362 caattggtatcagagcaggtcgatccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgctgttgctactt 16932264  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| |||||||||| |||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  ||||||    
16932263 ttgtagaatatcagaaatggctggaaggaatgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgtgaatgct 16932164  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||    
16932163 ggtgcgaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctta 16932064  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| |||||||||||||||||||||||| || |||||| |||||||| |||||||  |  | |||||||||||| || |||    
16932063 aggagattgagaggattttccgagttatgcagtgcactgaagatcag-aaggtgcggtttggtactcatcagctggccgangaagctgatgactggtggg 16931965  T
548 ttg 550  Q
    |||    
16931964 ttg 16931962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 270; E-Value: 1e-150
Query Start/End: Original strand, 148 - 550
Target Start/End: Complemental strand, 17002855 - 17002455
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
17002855 caattggtatcagagcaggtcgatccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgctgttgctactt 17002757  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| |||||||||| |||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  ||||||    
17002756 ttgtagaatatcagaaatggctggaaggaatgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgtgaatgct 17002657  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||| ||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||    
17002656 ggtgcaaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctta 17002557  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |||||||| |||||||  |  | |||||||||||| || |||    
17002556 aggagattgagaggattttccgagttatgcagtgcactgaagatcag-aaagtgcggtttggtactcatcagctggccgaggaagctgatgactggtggg 17002458  T
548 ttg 550  Q
    |||    
17002457 ttg 17002455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 148 - 564
Target Start/End: Complemental strand, 24266225 - 24265811
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| | ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
24266225 caattggtatcagagcaggtcgatccgttcggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatctaatgttgttgttgctactt 24266127  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||||||||| || | |||||||||||||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |    
24266126 ttgaagaatctcggaaatggctggaagaaacgatgctgtgttagctgctgctctacaagttgttgcccaagctgtgggacaacaacctaacgcaaatgtt 24266027  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    |||||||| |||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||    
24266026 ggtgcgaacgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccaaacgtggctta 24265927  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| ||||||||||||| |||||||||| || |||||| |||||||| |||||||| |  | |||||||||||| || |||    
24265926 aggagattgagaggattttccgggttatgcagtgcattgaagatcag-aaggtgcggtttggtactcatcagctagccgaggaagctgatgactggtggg 24265828  T
548 ttggncttctacctacc 564  Q
    |||  ||||| ||||||    
24265827 ttgctcttctgcctacc 24265811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 148 - 522
Target Start/End: Original strand, 41605671 - 41606043
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41605671 caattggtatcagagcaggtcggtccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 41605769  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| | ||| || | |||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||     
41605770 ttgtaaaatctcggtaatggctggaagaaacgatgttgcgttagctgctgctctacaagttgttgcccaagctgtgggacaacaacctaacgcaaatgcg 41605869  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||   |||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||| ||||||||||    
41605870 ggtgcgaatgctgaagctaggatgttggagactttcatgaagaagaaccctccaactttcaaagggcgttatgaccctgatggagcccagacgtggctta 41605969  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagcta 522  Q
    | | |||||||||||||||||| |||||||||||||||||||||||| || |||||| |||||||| ||||||||    
41605970 aggggattgagaggattttccgggttatgcagtgcactgaagatcag-aaggtgcggtttggtactcatcagcta 41606043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 265; E-Value: 1e-147
Query Start/End: Original strand, 148 - 564
Target Start/End: Complemental strand, 10872705 - 10872291
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10872705 caattggtatcagagcaggtcggtccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 10872607  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| |||||||||| |||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  ||||||    
10872606 ttgtagaatatcagaaatggctggaaggaatgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgtgaatgct 10872507  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||| ||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||    
10872506 ggtgcaaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctta 10872407  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||| ||| |||||||||||||| || |||||| ||||||||  |||||||| |||||||  |  | |||||||||||| || |||    
10872406 aggagattgagaggatttaccgggttatgcagtgcacggaggatcag-aaagtgcgatttggtactcatcagctggccgaggaagctgatgactggtggg 10872308  T
548 ttggncttctacctacc 564  Q
    |||  ||||| ||||||    
10872307 ttgctcttctgcctacc 10872291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 148 - 550
Target Start/End: Complemental strand, 16985095 - 16984695
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
16985095 caattggtatcagagcaggtcgatccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgctgttgctactt 16984997  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| |||||||| | |||||||||||| || |||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||||  ||||||    
16984996 ttgtagaatatccgaaatggctggaaggaatgatgctgcgttagctgctgctcttcaagctgttgcccaagctgtgggacaacaacctaacgtgaatgct 16984897  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||    
16984896 ggtgcgaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctta 16984797  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| |||||||||||||||||||||||| || |||||| |||||||| |||||||  |  | |||||||||||| || |||    
16984796 aggagattgagaggattttccgagttatgcagtgcactgaagatcag-aaggtgcggtttggtactcatcagctggccgatgaagctgatgactggtggg 16984698  T
548 ttg 550  Q
    |||    
16984697 ttg 16984695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 148 - 564
Target Start/End: Original strand, 22321930 - 22322344
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| | |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
22321930 caattggtatcagagcaggtcgatccgtccggtcaattaga-gagttgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 22322028  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| ||||| || | |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
22322029 ttgtagaatctcggaaatggctggaagaaacgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 22322128  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    |||||||| || ||   || |||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| | ||||||||    
22322129 ggtgcgaacgcggaagctatgatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagatgtggctta 22322228  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| |||||||||||||| || |||||| ||||||||| |||||||| |||||||  |  | |||||||||||| || |||    
22322229 aggagattgagaggattttccgggttatgcagtgcacggaggatcag-aaagtgcggtttggtactcatcagctggccgaggaagctgatgactggtggg 22322327  T
548 ttggncttctacctacc 564  Q
    |||  ||||| ||||||    
22322328 ttgctcttctgcctacc 22322344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 260; E-Value: 1e-144
Query Start/End: Original strand, 152 - 564
Target Start/End: Original strand, 44382160 - 44382572
Alignment:
152 tggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctacttttga 251  Q
    |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
44382160 tggtatcagagcaggtcggtccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctacttttgt 44382258  T
252 agaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgctggtg 351  Q
    ||||| || | |||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  || || |||     
44382259 agaatctcggaaatggctggaaggaacgatgttgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgtgaacgccggtt 44382358  T
352 cgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggcttaaaga 451  Q
    ||||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||| ||    
44382359 cgaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggcttaagga 44382458  T
452 gattgagaggattttcc--gtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccggggggtt 549  Q
    |||||||||||||||||  |||||||||||||||||||||||||| || |||||| |||||||| |||||||| |  | |||||||||||| || |||||    
44382459 gattgagaggattttccgagtgttatgcagtgcactgaagatcag-aaggtgcggtttggtactcatcagctagccgaggaagctgatgactggtgggtt 44382557  T
550 ggncttctacctacc 564  Q
    |  ||||| ||||||    
44382558 gctcttctgcctacc 44382572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 148 - 550
Target Start/End: Complemental strand, 9488072 - 9487671
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttg-ttgttgctact 246  Q
    |||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
9488072 caattggtatcagagcaggtcgatccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgattgttgctact 9487974  T
247 tttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgc 346  Q
    |||| |||||||| | |||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  |||||    
9487973 tttgtagaatatccgaaatggctggaaggaatgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgtgaatgc 9487874  T
347 tggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctt 446  Q
    |||||| ||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||    
9487873 tggtgcaaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctt 9487774  T
447 aaagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccggggg 546  Q
    || |||||||||||||||||||| |||||||||||||||||||||||| || |||||| |||||||| |||||||  |  | |||||||||||| || ||    
9487773 aaggagattgagaggattttccgagttatgcagtgcactgaagatcag-aaggtgcggtttggtactcatcagctggccgatgaagctgatgactggtgg 9487675  T
547 gttg 550  Q
    ||||    
9487674 gttg 9487671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 255; E-Value: 1e-141
Query Start/End: Original strand, 148 - 550
Target Start/End: Complemental strand, 9339438 - 9339037
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttg-ttgttgctact 246  Q
    |||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
9339438 caattggtatcagagcaggtcgatccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgattgttgctact 9339340  T
247 tttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgc 346  Q
    |||| |||||||| | |||||||||||| || |||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||  |||||    
9339339 tttgtagaatatccgaaatggctggaaggaatgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgagacaacaacctaacgtgaatgc 9339240  T
347 tggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctt 446  Q
    |||||| ||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||    
9339239 tggtgcaaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctt 9339140  T
447 aaagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccggggg 546  Q
    || |||||||||||||||||||| |||||||||||||||||||||||| || |||||| |||||||| |||||||  |  | |||||||||||| || ||    
9339139 aaggagattgagaggattttccgagttatgcagtgcactgaagatcag-aaggtgcggtttggtactcatcagctggccgatgaagctgatgactggtgg 9339041  T
547 gttg 550  Q
    ||||    
9339040 gttg 9339037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 240; E-Value: 1e-132
Query Start/End: Original strand, 148 - 539
Target Start/End: Original strand, 22462064 - 22462455
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    ||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |||    
22462064 caattggtatcagagaaggtcggtccgtccggtcaattagaagagtcttgtcgagtcttagtaatatttttattactatcttatgttgttgttgctgctt 22462163  T
248 -ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgc 346  Q
     ||| ||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
22462164 gttgtagaatatcaggaatggctggaaggaacgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgc 22462263  T
347 tggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctt 446  Q
    ||| | ||||||||||| ||||||||||||||| |||||||  ||  | ||||| |||||||||||| |||||||||  ||||||||||| |||||||||    
22462264 tggagtgaatgctgagactaggatgttggagaccttcatgagaaatcatcctccaactttcaaaggaagatatgaccacgatggagcccagacgtggctt 22462363  T
447 aaagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatga 539  Q
    ||||||||||| |||||||||||||| |||||||||||||| |  ||| ||||| ||  |||||||| |||||||| || | |||||||||||    
22462364 aaagagattgaaaggattttccgtgtgatgcagtgcactgaggtccag-aaagtacgatttggtactcatcagctagctgaggaagctgatga 22462455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 148 - 497
Target Start/End: Original strand, 24656241 - 24656591
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||    
24656241 caattggtatcagagcaggtcggtccgtccggccaattagaagagtcttgtcgagtcttagtaatatttgtattactatcttatgttgttgttgctactt 24656340  T
248 t-tgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgc 346  Q
      || |||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |    
24656341 gatgtagaatatcagaaatggctggaagaaacgatgttgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgcgaatac 24656440  T
347 tggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctt 446  Q
    || || ||||||||||| |||||||||||||| |||||||| |||  | ||||| || ||||||||| |||||||||| ||||||||||| |||||||||    
24656441 tgttgtgaatgctgagactaggatgttggagaatttcatgaggaatcatcctccaaccttcaaaggaagatatgaccccgatggagcccagacgtggctt 24656540  T
447 aaagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaa 497  Q
    || ||||||||||||||||||||||| |||||||||||||| | |||||||    
24656541 aaggagattgagaggattttccgtgtgatgcagtgcactgaggttcagaaa 24656591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 181; E-Value: 2e-97
Query Start/End: Original strand, 148 - 564
Target Start/End: Original strand, 23028046 - 23028461
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| ||| ||||||| |||||||||||||| |||| |||||||||||||||| | ||||||||||||||||||||| |   ||    
23028046 caattggtatcagagcaggtcggttcgtccggccaattagaagagtcatgtcaagtcttagtaatatttgttttactatcttatgttgttgttacctatt 23028145  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
     || |||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||| || ||||||||||||||||| ||||| |||||||||    
23028146 gtgtagaatatcagaaatggctggaagaaaagatggtgcgttagctgctgcactacaagctgtagctcaagctgtgggacaacagcctaatgcaaatgct 23028245  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    |||| |||||||||||  |||||| | ||||| ||||||| |||  | ||| | |||||||| ||| ||||||||||||| |||||| |  |||||||||    
23028246 ggtgtgaatgctgagacgaggatgcttgagaccttcatgaggaatcatcctgctactttcaagggaagatatgaccctgacggagcctagtcgtggctta 23028345  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | ||||| |||||  |||||||||| ||||||||||||||||||||| || |||||  |||||||  || ||||  || | |||||||||||  || |||    
23028346 aggagatcgagagagttttccgtgtgatgcagtgcactgaagatcag-aaggtgcgatttggtacacattagctggctgaggaagctgatgattggtggg 23028444  T
548 ttggncttctacctacc 564  Q
    || | ||||||||||||    
23028445 ttagtcttctacctacc 23028461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 174; E-Value: 3e-93
Query Start/End: Original strand, 148 - 489
Target Start/End: Original strand, 22741550 - 22741891
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| ||||||||| | ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |   ||    
22741550 caattggtatcagagcaggtcggtccgtcctgccaattggaagagtcgtgtcgagtcttagtaatatttgtattactatcttatgttgttgttacctgtt 22741649  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
     || ||||| ||||  ||||||||||||||||| | |||||||||||||||||||||||| || || ||||||||||| ||||||||||| |||||||||    
22741650 gtgtagaatctcagagatggctggaagaaacgacgctgcgttagctgctgcactacaagccgtagctcaagctgtggggcaacaacctaatgcaaatgct 22741749  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    |||||||||||||||   |||||| | ||||| ||| ||| |||  | ||||| |||||||| ||| |||||||||| ||||||||||| ||||||||||    
22741750 ggtgcgaatgctgagtcgaggatgcttgagaccttcctgaggaatcatcctcctactttcaagggaagatatgaccccgatggagcccagacgtggctta 22741849  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaag 489  Q
    |||||||||||||  |||||||||| ||||| ||||| ||||    
22741850 aagagattgagagagttttccgtgtgatgcaatgcaccgaag 22741891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 165; E-Value: 7e-88
Query Start/End: Original strand, 148 - 564
Target Start/End: Original strand, 21319587 - 21320002
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||   ||    
21319587 caattggtatcagagcaggtcggtccgtccggccaattagaagaatcgtgtcgagtcttagtaatatttgtattactatcttatgttgttgttgcctgtt 21319686  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
     || ||||||||||  |||||  ||||| | ||||||||||||||||||||||| |||||| | || ||||||||||||||||| || ||  | |||| |    
21319687 gtgtagaatatcagagatggccagaagagatgatgatgcgttagctgctgcacttcaagctatagctcaagctgtgggacaacagccgaatacgaatgtt 21319786  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    || | |||||||||||  |||||| | ||||||||||||| |||  | ||||| |||||||| ||| |||||||||||||||||||||| |||||||| |    
21319787 ggagtgaatgctgagacgaggatgctagagactttcatgaggaatcatcctccaactttcaagggaagatatgaccctgatggagcccagacgtggctca 21319886  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | ||||| || |||||||||||||| ||||||||||| || | |||| || |||||  |||||||  |||||||  || | |||| ||||||  || |||    
21319887 aggagatcgaaaggattttccgtgtgatgcagtgcaccgaggttcag-aaggtgcgatttggtacagatcagctggctgaggaagttgatgattggtggg 21319985  T
548 ttggncttctacctacc 564  Q
    || | ||||||||||||    
21319986 ttagtcttctacctacc 21320002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 153; E-Value: 1e-80
Query Start/End: Original strand, 148 - 564
Target Start/End: Complemental strand, 20321846 - 20321424
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||||   |    
20321846 caattggtatcagagcaggtcggtccgtccggccaattagaagagttgtgtcgagttttagtaatagttatattactatcttatgttgttgttgcttgat 20321747  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacct------aacgca 341  Q
     || ||||  | ||  ||||||||||||||||| | |||||||||||||||||||||||| || ||  ||||||||||||||||||||      || |||    
20321746 gtgtagaaactaagagatggctggaagaaacgacgttgcgttagctgctgcactacaagcagtagcttaagctgtgggacaacaacctaatgcaaatgca 20321647  T
342 aatgctggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaa-ggacgatatgaccctgatggagcccaaacg 440  Q
    |||||||||||||||||||||   |||||| | ||||| ||| ||| |||  | ||||| ||||| ||| ||| |||||||||| |||||| |||| |||    
20321646 aatgctggtgcgaatgctgagtcgaggatgcttgagaccttcctgaggaatcatcctcctacttttaaagggaagatatgaccccgatggatcccagacg 20321547  T
441 tggcttaaagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgac 540  Q
    ||||||||||||||||| ||  |||||||||||||||| |||||||||| |||| || |||||  |||||||  ||||| |  || | |||||||||||     
20321546 tggcttaaagagattgaaagagttttccgtgttatgcaatgcactgaagttcag-aaggtgcgatttggtacacatcagttggctgaggaagctgatgat 20321448  T
541 cggggggttggncttctacctacc 564  Q
     || ||||| | ||||||||||||    
20321447 tggtgggttagtcttctacctacc 20321424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 153; E-Value: 1e-80
Query Start/End: Original strand, 148 - 564
Target Start/End: Complemental strand, 24679346 - 24678931
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| |||||||| || || |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |   ||    
24679346 caattggtatcagagcaggtcggtccgtctggccagttagaagagtcgtgtcgagtcttaataatatttgtattactatcttatgttgttgttacctgtt 24679247  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
     || ||||  | ||  |||||  ||||| |||||| |||||||||||||||||||||||| || || ||||||||||||||||| ||||| |||||||||    
24679246 gtgtagaaactaagagatggccagaagagacgatgttgcgttagctgctgcactacaagccgtagcacaagctgtgggacaacagcctaatgcaaatgct 24679147  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    |||| |||||||||||  |||||| | ||||| || || | |||  | ||||| |||||||| ||| |||||||||| ||||||||||| ||||| ||||    
24679146 ggtgtgaatgctgagacgaggatgcttgagacctttattaggaatcatcctcctactttcaagggaagatatgaccccgatggagcccagacgtgactta 24679047  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | ||||| |||||  |||||||||||||||| |||| |||||||||| || |||||  |||||||  |||||||  |  | |||||||||||  || |||    
24679046 aggagatcgagagagttttccgtgttatgcaatgcattgaagatcag-aaggtgcgatttggtacacatcagcttgccgaggaagctgatgattggtggg 24678948  T
548 ttggncttctacctacc 564  Q
    || | ||||||||||||    
24678947 ttagtcttctacctacc 24678931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 145; E-Value: 6e-76
Query Start/End: Original strand, 148 - 496
Target Start/End: Original strand, 23104316 - 23104659
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||   |    
23104316 caattggtatcagagcaggtcggtccgtccggccaattagaagagtcgtgtcgagttttagtaatagttatattactatcttatgttgttgttgcttgat 23104415  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
     || ||||  ||||  |||||||| |||||||| | |||||||||||||||||||||||| || || |||| |||||||||||| || || |||||||||    
23104416 gtgtagaaactcagagatggctggtagaaacgacgctgcgttagctgctgcactacaagccgtagctcaagttgtgggacaacagccaaatgcaaatgct 23104515  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    |||||||||||||     ||  || | ||||| ||| ||| |||  | ||||  |||||||| ||| |||||||||| ||||||||||| ||||||||||    
23104516 ggtgcgaatgctg-----agtctgcttgagaccttcctgaggaatcatcctcttactttcaagggaagatatgaccccgatggagcccagacgtggctta 23104610  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaa 496  Q
    ||||||  || ||  ||||||||||||||||||||| ||||| ||||||    
23104611 aagagacagaaagagttttccgtgttatgcagtgcattgaagttcagaa 23104659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 148 - 481
Target Start/End: Complemental strand, 23066233 - 23065901
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| |||||||| || ||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||  ||    
23066233 caattggtatcagagcaggtcggtccgtcaggccaattagaagagtcgtgtcgagttttagtaatagttatattactatcttatgttg-tgttgcttgtt 23066135  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
     || ||||  | ||  ||||||||||||| ||| | ||| |||||||||||||||||||| || || ||||||||||||||||||||||| || ||||||    
23066134 gtgtagaaattaagagatggctggaagaaccgacgctgccttagctgctgcactacaagccgtagctcaagctgtgggacaacaacctaatgcgaatgct 23066035  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||| | || |||    |||||| | ||||| ||  ||| |||  | ||||  |||||||| ||| |||||||||||||||||||||| |||||||| |    
23066034 ggtgcaagtgttgaagtgaggatgctagagacctttctgaggaatcatcctcttactttcaagggaagatatgaccctgatggagcccagacgtggctca 23065935  T
448 aagagattgagaggattttccgtgttatgcagtg 481  Q
    |||||||||||||  | ||| |||| ||||||||    
23065934 aagagattgagagagtgttcagtgtaatgcagtg 23065901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 148 - 481
Target Start/End: Complemental strand, 23075683 - 23075351
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| |||||||| || ||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||  ||    
23075683 caattggtatcagagcaggtcggtccgtcaggccaattagaagagtcgtgtcgagttttagtaatagttatattactatcttatgttg-tgttgcttgtt 23075585  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
     || ||||  | ||  ||||||||||||| ||| | ||| |||||||||||||||||||| || || ||||||||||||||||||||||| || ||||||    
23075584 gtgtagaaattaagagatggctggaagaaccgacgctgccttagctgctgcactacaagccgtagctcaagctgtgggacaacaacctaatgcgaatgct 23075485  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||| | || |||    |||||| | ||||| ||  ||| |||  | ||||  |||||||| ||| |||||||||||||||||||||| |||||||| |    
23075484 ggtgcaagtgttgaagtgaggatgctagagacctttctgaggaatcatcctcttactttcaagggaagatatgaccctgatggagcccagacgtggctca 23075385  T
448 aagagattgagaggattttccgtgttatgcagtg 481  Q
    |||||||||||||  | ||| |||| ||||||||    
23075384 aagagattgagagagtgttcagtgtaatgcagtg 23075351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 125; E-Value: 5e-64
Query Start/End: Original strand, 148 - 562
Target Start/End: Original strand, 24704092 - 24704479
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    ||||||||||||||| |||| |||||| ||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |  ||  ||    
24704092 caattggtatcagagtaggtcggtccgcccggctaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttttacctg-tt 24704190  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
     || |||||||||  |||||||||||||||||||| ||||||||||| |||||||||||||||            ||| |||||||||||              
24704191 gtgtagaatatcat-aatggctggaagaaacgatgctgcgttagctgttgcactacaagctgt------------ggggcaacaacctaa---------- 24704267  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
      ||||||||||||||  |||||| | ||||||||||||| |||  | ||||| |||||||| ||| |||||||||||||||||||| | ||||||||||    
24704268 --tgcgaatgctgagacgaggatgctagagactttcatgaggaatcatcctcctactttcaagggaagatatgaccctgatggagcctagacgtggctta 24704365  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | ||||| ||||||||||||||||| |||||||  ||||| | |||| ||||||||  |||||||  |||||||| || | |||||||||||  || |||    
24704366 aggagatcgagaggattttccgtgtgatgcagtaaactgaggttcag-aaagtgcgttttggtacgcatcagctagctgaggaagctgatgattggtggg 24704464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 123; E-Value: 8e-63
Query Start/End: Original strand, 148 - 481
Target Start/End: Original strand, 22732360 - 22732691
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||  |     
22732360 caattggtatcagagcaggtcggtccgtccggccaattagaagagtcgtgtcgagttttagtaatagttatattactatcttatgttgatgttgct--tg 22732457  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| |||   | ||  |||||| ||||| ||||   ||||||||||| |||||||||||  || ||  |||||||||||||||||||| | |||||||||    
22732458 ttgtagagactaagagatggctagaagagacgacactgcgttagctgatgcactacaagtcgtagcttaagctgtgggacaacaacctgatgcaaatgct 22732557  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||    |||||| | ||||| ||  ||| |||  | ||||| |||||||| ||| |||||||||||||||||||||| ||||||||      
22732558 ggtgcgaatgctgaagtgaggatgctagagacctttctgaggaatcatcctcctactttcaagggaagatatgaccctgatggagcccagacgtggctcc 22732657  T
448 aagagattgagaggattttccgtgttatgcagtg 481  Q
    ||||||| |||||  | |||||||| ||||||||    
22732658 aagagatggagagagtgttccgtgtgatgcagtg 22732691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 264 - 496
Target Start/End: Complemental strand, 23030504 - 23030272
Alignment:
264 atggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgctggtgcgaatgctgaga 363  Q
    ||||||||||||||||| | |||||||||||||||||||||||  || || |||||||| |||||||| ||||| ||||||||||||||||||||||||     
23030504 atggctggaagaaacgacgctgcgttagctgctgcactacaagtcgtagctcaagctgttggacaacagcctaatgcaaatgctggtgcgaatgctgagt 23030405  T
364 ataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggcttaaagagattgagaggat 463  Q
      |||||| | || || ||  ||| |||  | ||||| |||||||| ||| |||||||| | ||||||||||| | ||||||||| ||||| || ||  |    
23030404 cgaggatgcttgatacctttttgaggaatcatcctcctactttcaagggaagatatgactccgatggagcccagatgtggcttaaggagatagaaagagt 23030305  T
464 tttccgtgttatgcagtgcactgaagatcagaa 496  Q
    |||||||||||| ||||||||||||| ||||||    
23030304 tttccgtgttatacagtgcactgaagttcagaa 23030272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 148 - 229
Target Start/End: Original strand, 27381727 - 27381808
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatctt 229  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||| ||||| |||||||||    
27381727 caattggtatcagagcaggttggtccgtccggccaattagaagagtcgtgttgagttttagtaatagttataatactatctt 27381808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 315 - 496
Target Start/End: Original strand, 24816590 - 24816771
Alignment:
315 caagctgtgggacaacaacctaacgcaaatgctggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggac 414  Q
    |||| |||||| ||||| ||||| || ||||||||||| ||||| ||   |||||||||||| |||||  ||| |||  | ||||| ||||||||||||     
24816590 caagttgtggggcaacagcctaatgctaatgctggtgctaatgccgaagttaggatgttggaaacttttctgaggaatcatcctcctactttcaaaggaa 24816689  T
415 gatatgaccctgatggagcccaaacgtggcttaaagagattgagaggattttccgtgttatgcagtgcactgaagatcagaa 496  Q
    | ||||| || |||| ||| || |||||||| |||||| |||||||||||||||| |||||||| |||| ||| | ||||||    
24816690 ggtatgatccagatgtagctcagacgtggctcaaagaggttgagaggattttccgagttatgcaatgcaatgaggttcagaa 24816771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 148 - 225
Target Start/End: Complemental strand, 24646401 - 24646324
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattacta 225  Q
    |||||||||||||||| ||| |||| |||||| ||||||||||||||||||||||| || |||||| |||||||||||    
24646401 caattggtatcagagctggtcggtctgtccggccaattagaagagtcgtgtcgagttttggtaatagttatattacta 24646324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 290 - 363
Target Start/End: Original strand, 23039346 - 23039419
Alignment:
290 agctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgctggtgcgaatgctgaga 363  Q
    |||||||||||||||||  || || ||||||||||||||||| ||||| ||||||| |||||||||||||||||    
23039346 agctgctgcactacaagtcgtagcacaagctgtgggacaacagcctaatgcaaatgatggtgcgaatgctgaga 23039419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 6484449 - 6484399
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||||||||||||||| ||| ||| ||||||||||    
6484449 caattggtatcagagcaggttggtccgtccggccaaatagtagagtcgtgt 6484399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 12571750 - 12571700
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||||||||||||||| ||| ||| ||||||||||    
12571750 caattggtatcagagcaggttggtccgtccggccaagtagtagagtcgtgt 12571700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 12578232 - 12578182
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||||||||||||||| ||| ||| ||||||||||    
12578232 caattggtatcagagcaggttggtccgtccggccaagtagtagagtcgtgt 12578182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 198
Target Start/End: Original strand, 21240351 - 21240401
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||||||||||||||| ||| ||| ||||||||||    
21240351 caattggtatcagagcaggttggtccgtccggccaagtagtagagtcgtgt 21240401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 198
Target Start/End: Original strand, 23096592 - 23096642
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||||||||||||||| ||| ||| ||||||||||    
23096592 caattggtatcagagcaggttggtccgtccggccaagtagtagagtcgtgt 23096642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 23296912 - 23296862
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||||||||||||||| ||| ||| ||||||||||    
23296912 caattggtatcagagcaggttggtccgtccggccaagtagtagagtcgtgt 23296862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 27790347 - 27790297
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||||||||||||||| ||| ||| ||||||||||    
27790347 caattggtatcagagcaggttggtccgtccggccaagtagtagagtcgtgt 27790297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 31505022 - 31504972
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||||||||||||||| ||| ||| ||||||||||    
31505022 caattggtatcagagcaggttggtccgtccggccaagtagtagagtcgtgt 31504972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 148 - 199
Target Start/End: Original strand, 19664421 - 19664472
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtc 199  Q
    |||||||||||||||||||||||||||||||| ||| |||  ||||||||||    
19664421 caattggtatcagagcaggttggtccgtccggccaagtagttgagtcgtgtc 19664472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 198
Target Start/End: Original strand, 19715588 - 19715638
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||||||||||||||| | | ||| ||||||||||    
19715588 caattggtatcagagcaggttggtccgtccggccgagtagtagagtcgtgt 19715638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 198
Target Start/End: Original strand, 19720151 - 19720201
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||||||||||||||| | | ||| ||||||||||    
19720151 caattggtatcagagcaggttggtccgtccggccgagtagtagagtcgtgt 19720201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 24644190 - 24644140
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||| ||||||||||||||||||||||||| ||| ||| ||||||||||    
24644190 caattgatatcagagcaggttggtccgtccggccaagtagtagagtcgtgt 24644140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 28351748 - 28351698
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    |||||||||||||||||||||||||||||||| | | ||| ||||||||||    
28351748 caattggtatcagagcaggttggtccgtccggccgagtagtagagtcgtgt 28351698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 264 - 496
Target Start/End: Complemental strand, 21902280 - 21902048
Alignment:
264 atggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgctggtgcgaatgctgaga 363  Q
    ||||||||||||||||||| |||  | |||||||||||  ||||| | || |||||||| |||||||| || || ||   ||||||||| |||| || ||    
21902280 atggctggaagaaacgatgctgctattgctgctgcacttgaagctatagctcaagctgtaggacaacatccgaatgctggtgctggtgcaaatgatg-ga 21902182  T
364 at-aggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggcttaaagagattgagagga 462  Q
     | ||| ||||||| |||||  |||  ||  | || || |||||||||||| |||| || ||||| ||||| || | ||||||||||||| | |||||||    
21902181 gtgaggttgttggaaacttttctgagaaatcatccaccaactttcaaaggaagatacgatcctgacggagctcagaagtggcttaaagaggtggagagga 21902082  T
463 ttttccgtgttatgcagtgcactgaagatcagaa 496  Q
    | ||| | || ||||| |||| ||||| ||||||    
21902081 tcttcagggtcatgcaatgcagtgaagttcagaa 21902048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 148 - 204
Target Start/End: Complemental strand, 23132445 - 23132389
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtc 204  Q
    |||||||||||||||||||| ||||||||||| ||| |||  |||||||||| ||||    
23132445 caattggtatcagagcaggtcggtccgtccggccaagtagttgagtcgtgtcaagtc 23132389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 148 - 204
Target Start/End: Original strand, 23710593 - 23710649
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtc 204  Q
    |||||||||||||||||||| ||||||||||| ||| |||  |||||||||| ||||    
23710593 caattggtatcagagcaggtcggtccgtccggccaagtagttgagtcgtgtcaagtc 23710649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 148 - 204
Target Start/End: Original strand, 24899264 - 24899320
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtc 204  Q
    |||||||||||||||||||| ||||||||||| ||| |||  |||||||||| ||||    
24899264 caattggtatcagagcaggtcggtccgtccggccaaatagttgagtcgtgtcaagtc 24899320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 148 - 204
Target Start/End: Original strand, 24901741 - 24901797
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtc 204  Q
    |||||||||||||||||||| ||||||||||| ||| |||  |||||||||| ||||    
24901741 caattggtatcagagcaggtcggtccgtccggccaagtagttgagtcgtgtcaagtc 24901797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 148 - 204
Target Start/End: Original strand, 24904218 - 24904274
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtc 204  Q
    |||||||||||||||||||| ||||||||||| ||| |||  |||||||||| ||||    
24904218 caattggtatcagagcaggtcggtccgtccggccaagtagttgagtcgtgtcaagtc 24904274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 148 - 204
Target Start/End: Original strand, 24906693 - 24906749
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtc 204  Q
    |||||||||||||||||||| ||||||||||| ||| |||  |||||||||| ||||    
24906693 caattggtatcagagcaggtcggtccgtccggccaagtagttgagtcgtgtcaagtc 24906749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 198
Target Start/End: Complemental strand, 1066341 - 1066294
Alignment:
151 ttggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    ||||||||||||||||||||||||||||  ||| ||| ||||||||||    
1066341 ttggtatcagagcaggttggtccgtccgaccaagtagtagagtcgtgt 1066294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 183
Target Start/End: Original strand, 20320332 - 20320367
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaa 183  Q
    |||||||||||||||||||| |||||||||||||||    
20320332 caattggtatcagagcaggtcggtccgtccggtcaa 20320367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 198
Target Start/End: Complemental strand, 20849457 - 20849410
Alignment:
151 ttggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    ||||||||| ||||||||||||||||||| ||| ||| ||||||||||    
20849457 ttggtatcaaagcaggttggtccgtccggccaagtagtagagtcgtgt 20849410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 262 - 325
Target Start/End: Complemental strand, 23003826 - 23003763
Alignment:
262 gaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtggg 325  Q
    ||||||||||| ||||||||| |||| | |||||||||||| ||| ||| || |||||||||||    
23003826 gaatggctggacgaaacgatgctgcgattgctgctgcactagaagttgtggctcaagctgtggg 23003763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 198
Target Start/End: Complemental strand, 31833248 - 31833201
Alignment:
151 ttggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgt 198  Q
    ||||||||||||||||||||||||||||  ||| ||| ||||||||||    
31833248 ttggtatcagagcaggttggtccgtccgaccaagtagtagagtcgtgt 31833201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 148 - 196
Target Start/End: Complemental strand, 19803019 - 19802971
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgt 196  Q
    |||||||||||||||||||||||||| ||||| ||| |||  |||||||    
19803019 caattggtatcagagcaggttggtccatccggccaagtagttgagtcgt 19802971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 148 - 196
Target Start/End: Complemental strand, 19818668 - 19818620
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgt 196  Q
    |||||||||||||||||||| ||||||||||| ||| |||  |||||||    
19818668 caattggtatcagagcaggtcggtccgtccggccaagtagttgagtcgt 19818620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 148 - 204
Target Start/End: Complemental strand, 26506959 - 26506903
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtc 204  Q
    |||||||||||||||||||| |||||||| || ||| |||  |||||||||| ||||    
26506959 caattggtatcagagcaggtcggtccgtctggccaagtagttgagtcgtgtcaagtc 26506903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 148 - 196
Target Start/End: Complemental strand, 45535363 - 45535315
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgt 196  Q
    |||||||||||||||||||| ||||||||||| ||| |||  |||||||    
45535363 caattggtatcagagcaggtcggtccgtccggccaagtagtcgagtcgt 45535315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 325; Significance: 0; HSPs: 61)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 152 - 564
Target Start/End: Complemental strand, 22352072 - 22351661
Alignment:
152 tggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctacttttga 251  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
22352072 tggtatcagagcaggtcggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctacttttgt 22351973  T
252 agaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgctggtg 351  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22351972 agaatatcaggaatggctggaagaaacgatgctgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgctggtg 22351873  T
352 cgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggcttaaaga 451  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||| ||||||||||||||    
22351872 cgaatgctgagactaggatgttggagactttcatgaagaagaaccctctaactttcaaaggacgatatgaccctgatggagcccagacgtggcttaaaga 22351773  T
452 gattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccggggggttgg 551  Q
    |||||||||||||||||| ||||||||||||||| | |||||| ||||||||| | || ||| |||||||| || | |||||||||||| || |||||||    
22351772 gattgagaggattttccgggttatgcagtgcactaaggatcag-aaagtgcggttcggcactcatcagctagctgaggaagctgatgactggtgggttgg 22351674  T
552 ncttctacctacc 564  Q
     ||||| ||||||    
22351673 tcttctgcctacc 22351661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 148 - 564
Target Start/End: Original strand, 29472303 - 29472717
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29472303 caattggtatcagagcaggtcggtccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 29472401  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| ||||||||||||||||||||||||||||||| |||||||||||||||  |||||||||||||| ||||||||||||||||||||||||||||||||    
29472402 ttgtagaatatcaggaatggctggaagaaacgatgctgcgttagctgctgctttacaagctgttgcctaagctgtgggacaacaacctaacgcaaatgct 29472501  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||   |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||    
29472502 ggtgcgaatgctgaagctaggatgttggagactttcatgaagaagaaccctccaactttcaaaggacgttatgaccctgatggagcccagacgtggctta 29472601  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | ||||||||||||||||| || ||||||||||||||||| |||||| ||||||||| |||||| | |||||||| |  | |||||||||||| || |||    
29472602 aggagattgagaggatttttcgggttatgcagtgcactgaggatcag-aaagtgcggtttggtattcatcagctagccgaggaagctgatgactggtggg 29472700  T
548 ttggncttctacctacc 564  Q
    |||  ||||| ||||||    
29472701 ttgctcttctgcctacc 29472717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 148 - 564
Target Start/End: Original strand, 27681630 - 27682044
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27681630 caattggtatcagagcaggttgatccgttcggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 27681728  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| ||||| || | |||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||    
27681729 ttgtagaatctcggaaatggctggaagaaacgatgttgcgttagctgctgctctacaagttgttgcccaagctgtgggacaacaacctaacgcaaatgct 27681828  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||    ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||    
27681829 ggtgcgaatgctgaagccaggatgttggagactttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctta 27681928  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| |||||||||||||||||||||||| || |||||| |||||||| |||||||| |  | |||||||||||| || |||    
27681929 aggagattgagaggattttccgggttatgcagtgcactgaagatcag-aaggtgcggtttggtactcatcagctagccgaggaagctgatgactggtggg 27682027  T
548 ttggncttctacctacc 564  Q
    |||  ||||| ||||||    
27682028 ttgctcttctgcctacc 27682044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 148 - 564
Target Start/End: Complemental strand, 22138824 - 22138410
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    ||||||||||||||||||||  ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22138824 caattggtatcagagcaggtcagtccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 22138726  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| |||||||||  |||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||    
22138725 ttgtagaatatcataaatggctggaagaaacgatgctgcgttagctgctgctctacaagttgttgcccaagctgtgggacaacaacctaacgcaaatgct 22138626  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||    
22138625 ggtgcgaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccaactttcaaaggacgttatgaccctgatggagcccagacgtggctta 22138526  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | ||||||||||| |||||||| ||||||||||||||||| |||||| ||||||| | |||||||| |||||||| |  | |||||||||||| || |||    
22138525 aggagattgagagaattttccgggttatgcagtgcactgaggatcag-aaagtgcagtttggtactcatcagctagccgaggaagctgatgactggtggg 22138427  T
548 ttggncttctacctacc 564  Q
    |||  ||||| ||||||    
22138426 ttgctcttctgcctacc 22138410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 148 - 564
Target Start/End: Complemental strand, 27614513 - 27614098
Alignment:
148 caattggtatcagagca-ggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctact 246  Q
    |||||||||||| |||  |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27614513 caattggtatcaaagcctggttggtccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctact 27614415  T
247 tttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgc 346  Q
    |||| |||||||||| |||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  |||||    
27614414 tttgtagaatatcagaaatggctggaaggaatgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgtgaatgc 27614315  T
347 tggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctt 446  Q
    |||||||||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||    
27614314 tggtgcgaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctt 27614215  T
447 aaagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccggggg 546  Q
    || |||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |||||||| |||||||| |  | |||||||||||| || ||    
27614214 aaggagattgagaggattttccgagttatgcagtgcactgaagatcag-aaagtgcggtttggtactcatcagctagccgaggaagctgatgactggtgg 27614116  T
547 gttggncttctacctacc 564  Q
    ||||  ||||| ||||||    
27614115 gttgctcttctgcctacc 27614098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 148 - 564
Target Start/End: Complemental strand, 19774117 - 19773702
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19774117 caattggtatcagagcaggtcggtcggtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 19774018  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| ||||| |  | |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  |||||     
19774017 ttgtagaatcttggaaatggctggaagaaacgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgtgaatgcc 19773918  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||    
19773917 ggtgcgaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctta 19773818  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| |||||||||||||| || |||||| ||||||||| | |||||| |||||||| |  | |||||||||||| || |||    
19773817 aggagattgagaggattttccgggttatgcagtgcacggaggatcag-aaagtgcggttcggtactcatcagctagccgaggaagctgatgactggtggg 19773719  T
548 ttggncttctacctacc 564  Q
    |||  ||||| ||||||    
19773718 ttgctcttctgcctacc 19773702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 148 - 550
Target Start/End: Original strand, 22329105 - 22329517
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgtt------------g 235  Q
    |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||            |    
22329105 caattggtatcagagcaggtcggtccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgttgttg 22329203  T
236 ttgttgctacttttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacct 335  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||    
22329204 ttgttgctacttttgtagaatatcaggaatggctggaagaaacgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacct 22329303  T
336 aacgcaaatgctggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagccc 435  Q
    ||| ||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||    
22329304 aacacaaatgctggtgcgaatgctgaagctaggatgttggagactttcatgaagaagaaccctccaactttcaaaggacgttatgaccctgatggagccc 22329403  T
436 aaacgtggcttaaagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctg 535  Q
    | ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| ||||||||| |||||||| |||||||| |  | |||||||    
22329404 agacgtggcttaaggagattgagaggattttccgggttatgcagtgcactgaggatcag-aaagtgcggtttggtactcatcagctagccgaggaagctg 22329502  T
536 atgaccggggggttg 550  Q
    ||||| || ||||||    
22329503 atgactggtgggttg 22329517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 148 - 564
Target Start/End: Complemental strand, 41774999 - 41774585
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41774999 caattggtatcagagcagggtggtccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 41774901  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| ||||| || | |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
41774900 ttgtagaatctcggaaatggctggaagaaacgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 41774801  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    |||||||| || |    ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||     
41774800 ggtgcgaacgcgggagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggcttc 41774701  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| |||||||||||||| || |||||| ||||||||  |||||||| |||||||| |  | |||||||||||| || |||    
41774700 aggagattgagaggattttccgggttatgcagtgcacggaggatcag-aaagtgcgatttggtactcatcagctagccgaggaagctgatgactggtggg 41774602  T
548 ttggncttctacctacc 564  Q
    |||  ||||| ||||||    
41774601 ttgctcttctgcctacc 41774585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 265; E-Value: 1e-147
Query Start/End: Original strand, 148 - 564
Target Start/End: Original strand, 27664733 - 27665147
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27664733 caattggtatcagagcaggtcggtccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 27664831  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| ||||| || | |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  |||||     
27664832 ttgtagaatctcggaaatggctggaagaaacgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgtgaatgcc 27664931  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||    
27664932 ggtgcgaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctta 27665031  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||| |  ||||||||||||| || |||||| ||||||||| |||||||| |||||||| |  | ||||| |||||| || |||    
27665032 aggagattgagaggattttctggattatgcagtgcacggaggatcag-aaagtgcggtttggtactcatcagctagccgaggaagccgatgactggtggg 27665130  T
548 ttggncttctacctacc 564  Q
    |||  ||||| ||||||    
27665131 ttgctcttctgcctacc 27665147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 265; E-Value: 1e-147
Query Start/End: Original strand, 148 - 564
Target Start/End: Original strand, 37287727 - 37288140
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37287727 caattggtatcagagcaggtcggtccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 37287825  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| ||||| |||| |||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||  ||||||||||||||||||||||||||||    
37287826 ttgtagaatctcag-aatggctggaagaaacgatgctgcgttagctgctgctctacaagttgttgcccaaattgtgggacaacaacctaacgcaaatgct 37287924  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    |||||||| |||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||    
37287925 ggtgcgaacgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctta 37288024  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| ||||||||||||||||| |||||| || |||||| |||||||| ||||| || |  | |||||||||||| || | |    
37288025 aggagattgagaggattttccgggttatgcagtgcactgaggatcag-aaggtgcggtttggtactcatcagttagccgaggaagctgatgactggtgag 37288123  T
548 ttggncttctacctacc 564  Q
    |||  ||||| ||||||    
37288124 ttgctcttctgcctacc 37288140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 148 - 550
Target Start/End: Complemental strand, 16360659 - 16360258
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttg-ttgttgctact 246  Q
    |||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
16360659 caattggtatcagagcaggtcgatccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgattgttgctact 16360561  T
247 tttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgc 346  Q
    |||| |||||||| | |||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  |||||    
16360560 tttgtagaatatccgaaatggctggaaggaatgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgtgaatgc 16360461  T
347 tggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctt 446  Q
    |||||| ||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||    
16360460 tggtgcaaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctt 16360361  T
447 aaagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccggggg 546  Q
    || |||||||||||||||||||| |||||||||||||||||||||||| || |||||| |||||||| |||||||  |  | |||||||||||| || ||    
16360360 aaggagattgagaggattttccgagttatgcagtgcactgaagatcag-aaggtgcggtttggtactcatcagctggccgatgaagctgatgactggtgg 16360262  T
547 gttg 550  Q
    ||||    
16360261 gttg 16360258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 148 - 550
Target Start/End: Complemental strand, 34570648 - 34570250
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||  ||||||||||||||    
34570648 caattggtatcagagcaggtcggtccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatt-atattactatcttatactgttgttgctactt 34570551  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    |||||||||||||| |||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  ||||||    
34570550 ttgaagaatatcag-aatggctggaaggaatgatgctgcgttagctgctgctctacaagctgttgcccaagctgtgggacaacaacctaacgtgaatgct 34570452  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||| ||||||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||    
34570451 ggtgcaaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgactttcaaaggacgttatgaccctgatggagcccagacgtggctta 34570352  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| |||||||||||||||||||||||| || |||||| |||||||| |||||||  |  | |||||||||||| || |||    
34570351 aggagattgagaggattttccgagttatgcagtgcactgaagatcag-aaggtgcggtttggtactcatcagctggccgatgaagctgatgactggtggg 34570253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 148 - 550
Target Start/End: Complemental strand, 40712936 - 40712536
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40712936 caattggtatcagagcaggtcgatccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 40712838  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| |||||||||| |||||||||||| || |||| ||||||||||||||| || |||||||||||||||||||||||||||||| ||||||  ||||||    
40712837 ttgtagaatatcagaaatggctggaaggaatgatgctgcgttagctgctgctcttcaagctgttgcccaagctgtgggacaacaatctaacgtgaatgct 40712738  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||| ||||||||   ||||||||||||||| |||||||||||||||||||| | |||||||||||| |||||||||||||||||||| ||||||||||    
40712737 ggtgcaaatgctgaagctaggatgttggagacgttcatgaagaagaaccctccgattttcaaaggacgttatgaccctgatggagcccagacgtggctta 40712638  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg 547  Q
    | |||||||||||||||||||| |||||||||||||||||||||||| || |||||| |||||||| |||||||  |  | |||||||||||| || |||    
40712637 aggagattgagaggattttccgagttatgcagtgcactgaagatcag-aaggtgcggtttggtactcatcagctggccgaggaagctgatgactggtggg 40712539  T
548 ttg 550  Q
    |||    
40712538 ttg 40712536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 148 - 549
Target Start/End: Original strand, 14995981 - 14996368
Alignment:
148 caattggtatcagagcaggttggtccgtccggtcaattagaagagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 247  Q
    |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14995981 caattggtatcagagcaggtcggtccgtccggtcaattaga-gagtcgtgtcgagtcttagtaatatttatattactatcttatgttgttgttgctactt 14996079  T
248 ttgaagaatatcaggaatggctggaagaaacgatgatgcgttagctgctgcactacaagctgttgcccaagctgtgggacaacaacctaacgcaaatgct 347  Q
    ||| ||||| || | |||||||||||||||||||| ||||||||||||||| |||||||            |||||||||||||||||||||||||||||    
14996080 ttgtagaatctcggaaatggctggaagaaacgatgttgcgttagctgctgctctacaag------------ctgtgggacaacaacctaacgcaaatgct 14996167  T
348 ggtgcgaatgctgagaataggatgttggagactttcatgaagaagaaccctcccactttcaaaggacgatatgaccctgatggagcccaaacgtggctta 447  Q
    ||||||||||||||   |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||    
14996168 ggtgcgaatgctgaagctaggatgttggagactttcatgaagaagaaccctccaactttcaaaggacgttatgaccctgatggagcccagacgtggctta 14996267  T
448 aagagattgagaggattttccgtgttatgcagtgcactgaagatcagaaaagtgcgggttggtactnatcagctanctnaagaagctgatgaccgggggg