View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_11_96 (Length: 442)

Name: J5_11_96
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_11_96
J5_11_96
[»] chr1 (10 HSPs)
chr1 (209-442)||(34977377-34977609)
chr1 (1-133)||(34977686-34977818)
chr1 (7-131)||(34984944-34985068)
chr1 (9-132)||(34991635-34991757)
chr1 (210-291)||(34984787-34984866)
chr1 (7-133)||(2303542-2303671)
chr1 (352-442)||(2303859-2303949)
chr1 (346-442)||(34984581-34984671)
chr1 (376-442)||(34991256-34991322)
chr1 (214-246)||(34991522-34991554)
[»] chr5 (3 HSPs)
chr5 (16-133)||(40582270-40582387)
chr5 (354-442)||(40581934-40582022)
chr5 (212-263)||(40582138-40582189)


Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 10)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 209 - 442
Target Start/End: Complemental strand, 34977609 - 34977377
Alignment:
209 gaagttttactttgataacagaaccagaaatattgccaatgcatttttacaattagatatggaagaaaatgttcaccttttctgacccttgggatggcgt 308  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
34977609 gaagttttactttgataacagaaccagaaatattgccaatgcatttttacaattagatatggaagaaaatgttcaccttttctgacccttgg-atggcgt 34977511  T
309 gtgatatctatccctttaggaaaccgtactctcgaggttctttaagtgttggatcccagaangaaccgtctcgaggttggggatttcgaataactcaagc 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
34977510 gtgatatctatccctttaggaaaccgtactctcgaggttctttaagtgttggatcccagaaggaaccgtctcgaggttggggatttcgaataactcaagc 34977411  T
409 ttttttagagaatgcaatgcncctttatcgataa 442  Q
    |||||||||||||||||||| |||||||||||||    
34977410 ttttttagagaatgcaatgctcctttatcgataa 34977377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 34977818 - 34977686
Alignment:
1 ccaatcacctacatattaacaacaaattatcactactgtggagattagactgctcagagtgaaaggattccaaccaaaaacctcttgagggcacaacaca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
34977818 ccaatcacctacatattaacaacaaattatcactactgtggagattagactgctcagaatgaaaggattccaaccaaaaacctcttgagggcacaacaca 34977719  T
101 ataagtatcttataattattgatgtagaataac 133  Q
    |||||||||||||||||||||||||||||||||    
34977718 ataagtatcttataattattgatgtagaataac 34977686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 7 - 131
Target Start/End: Complemental strand, 34985068 - 34984944
Alignment:
7 acctacatattaacaacaaattatcactactgtggagattagactgctcagagtgaaaggattccaaccaaaaacctcttgagggcacaacacaataagt 106  Q
    ||||||| |||||||||||||||| |||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||      
34985068 acctacagattaacaacaaattattactattgtggagattagactgctcagaatgtaaggattccaaccaaaaacctcttgagggcacaacacaataaaa 34984969  T
107 atcttataattattgatgtagaata 131  Q
    | |||||||||||||||||||||||    
34984968 accttataattattgatgtagaata 34984944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 9 - 132
Target Start/End: Complemental strand, 34991757 - 34991635
Alignment:
9 ctacatattaacaacaaattatcactactgtggagattagactgctcagagtgaaaggattccaaccaaaaacctcttgagggcacaacacaataagtat 108  Q
    ||||| |||||||||||||||| |||| |||||||||||||||||||||  || ||||||||||||||||||  |||||| |||||||||||||||  |     
34991757 ctacagattaacaacaaattattactattgtggagattagactgctcaggatgtaaggattccaaccaaaaaaatcttga-ggcacaacacaataaaaac 34991659  T
109 cttataattattgatgtagaataa 132  Q
    |||||||||||| |||||||||||    
34991658 cttataattattaatgtagaataa 34991635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 210 - 291
Target Start/End: Complemental strand, 34984866 - 34984787
Alignment:
210 aagttttactttgataacagaaccagaaatattgccaatgcatttttacaattagatatggaagaaaatgttcaccttttct 291  Q
    ||||||||||||||| ||||||||||||||||||||||| |||||||||||||  |||||||||||||||||||||||||||    
34984866 aagttttactttgatgacagaaccagaaatattgccaatacatttttacaatt--atatggaagaaaatgttcaccttttct 34984787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 7 - 133
Target Start/End: Original strand, 2303542 - 2303671
Alignment:
7 acctacatattaacaacaaattatcactactgtggagattagactgctcagagtgaaaggattccaaccaaaaacctcttgagggcaca---acacaata 103  Q
    ||||||| |||||||||||||||| ||||  ||||||||||||||||||||| ||||| |||||||||||||||||||||  || ||||   ||||| ||    
2303542 acctacagattaacaacaaattattactatggtggagattagactgctcagaatgaaatgattccaaccaaaaacctcttttggacacaaacacacagta 2303641  T
104 agtatcttataattattgatgtagaataac 133  Q
    |  | ||||||||||||||| |||||||||    
2303642 aaaaccttataattattgatctagaataac 2303671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 352 - 442
Target Start/End: Original strand, 2303859 - 2303949
Alignment:
352 aagtgttggatcccagaangaaccgtctcgaggttggggatttcgaataactcaagcttttttagagaatgcaatgcncctttatcgataa 442  Q
    ||||||||||| |||||| ||||  ||| |||||||||||||| ||||||||| | ||||||||||||||||||||| |||||||||||||    
2303859 aagtgttggattccagaaggaacattcttgaggttggggattttgaataactcgaacttttttagagaatgcaatgctcctttatcgataa 2303949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 346 - 442
Target Start/End: Complemental strand, 34984671 - 34984581
Alignment:
346 ttctttaagtgttggatcccagaangaaccgtctcgaggttggggatttcgaataactcaagcttttttagagaatgcaatgcncctttatcgataa 442  Q
    |||| ||||||||||||||||||| ||||      ||||||||| ||| |||||||||||| ||||||||||||||||||||| |||||||||||||    
34984671 ttctctaagtgttggatcccagaaggaac------gaggttgggcattccgaataactcaaacttttttagagaatgcaatgctcctttatcgataa 34984581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 376 - 442
Target Start/End: Complemental strand, 34991322 - 34991256
Alignment:
376 gtctcgaggttggggatttcgaataactcaagcttttttagagaatgcaatgcncctttatcgataa 442  Q
    |||| |||||||||||| ||||||||||||| ||||||||||||||| ||||| |||||||| ||||    
34991322 gtcttgaggttggggatctcgaataactcaaacttttttagagaatgtaatgctcctttatcaataa 34991256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 214 - 246
Target Start/End: Complemental strand, 34991554 - 34991522
Alignment:
214 tttactttgataacagaaccagaaatattgcca 246  Q
    ||||||||||| |||||||||||||||||||||    
34991554 tttactttgatgacagaaccagaaatattgcca 34991522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 74; Significance: 9e-34; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 16 - 133
Target Start/End: Complemental strand, 40582387 - 40582270
Alignment:
16 ttaacaacaaattatcactactgtggagattagactgctcagagtgaaaggattccaaccaaaaacctcttgagggcacaacacaataagtatcttataa 115  Q
    ||||||||||||||| |||| |||||||||||||||||| ||| ||||| |||||||||||||||||||||||||| |||||||||||   | |||||||    
40582387 ttaacaacaaattattactattgtggagattagactgcttagaatgaaatgattccaaccaaaaacctcttgagggtacaacacaatagaaaccttataa 40582288  T
116 ttattgatgtagaataac 133  Q
    ||||||| ||||||||||    
40582287 ttattgacgtagaataac 40582270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 354 - 442
Target Start/End: Complemental strand, 40582022 - 40581934
Alignment:
354 gtgttggatcccagaangaaccgtctcgaggttggggatttcgaataactcaagcttttttagagaatgcaatgcncctttatcgataa 442  Q
    |||||||||||||||| ||||||||| |||||||||||| | ||||||||||| |  |||||||||||||||||| |||||||||||||    
40582022 gtgttggatcccagaaggaaccgtcttgaggttggggatatggaataactcaaacaattttagagaatgcaatgctcctttatcgataa 40581934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 212 - 263
Target Start/End: Complemental strand, 40582189 - 40582138
Alignment:
212 gttttactttgataacagaaccagaaatattgccaatgcatttttacaatta 263  Q
    ||||| ||||||| |||||||||||||||||||||||  |||||||||||||    
40582189 gttttgctttgatgacagaaccagaaatattgccaatatatttttacaatta 40582138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110823 times since January 2019
Visitors: 1335