View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_12_19 (Length: 158)

Name: J5_12_19
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_12_19
J5_12_19
[»] chr8 (1 HSPs)
chr8 (1-134)||(31600331-31600464)


Alignment Details
Target: chr8 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 31600464 - 31600331
Alignment:
1 tttttatggtctaaatttaacacaactaagccataaacctctttgagtaatcatgcctattctcacctctggagagccaaattgtttggacagttctgaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
31600464 tttttatggtctaaatttaacacaactaagccataaacctctttgagtaaccatgcctattctcacctctggagagccaaattgtttggacagttctgaa 31600365  T
101 acagagtttaatgggtactaccttgcctattaat 134  Q
    ||||||||||||||||||||||||||||||||||    
31600364 acagagtttaatgggtactaccttgcctattaat 31600331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108218 times since January 2019
Visitors: 1329