View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_12_7 (Length: 237)

Name: J5_12_7
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] J5_12_7
[»] chr3 (3 HSPs)
chr3 (1-114)||(35986290-35986403)
chr3 (131-177)||(35986135-35986181)
chr3 (197-237)||(35986254-35986294)

Alignment Details
Target: chr3 (Bit Score: 69; Significance: 4e-31; HSPs: 3)
Name: chr3

Target: chr3; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 35986290 - 35986403
1 cacttcactagaagaaaatagaagtgtctagtatctattttatgtttctttttcgtagtaaaaattattannnnnnnaaataatttagtttgtt-agatg 99  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||       ||||||||||||||||| ||||     
35986290 cacttcactagaagaaaatagaagtgtctagtatatattttatgtttctttttcgtagtaaaaattatta-ttttttaaataatttagtttgttcagata 35986388  T
100 caactatatataaaa 114  Q
    |||||||||| ||||    
35986389 caactatataaaaaa 35986403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 131 - 177
Target Start/End: Original strand, 35986135 - 35986181
131 aaattaattcttcatattttgcgggattcaaataaacggaatcaaat 177  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||    
35986135 aaattaattcttcatattttgtgggattcaaataaacggaatcaaat 35986181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 197 - 237
Target Start/End: Original strand, 35986254 - 35986294
197 agaaaaaaccacttttttagcaatctaaattcgacacactt 237  Q
    ||||||||||||||||||||||||| |||||||||||||||    
35986254 agaaaaaaccacttttttagcaatccaaattcgacacactt 35986294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 360980 times since January 2019
Visitors: 487