View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_12_7 (Length: 237)
Name: J5_12_7
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5_12_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 4e-31; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 35986290 - 35986403
Alignment:
Q |
1 |
cacttcactagaagaaaatagaagtgtctagtatctattttatgtttctttttcgtagtaaaaattattannnnnnnaaataatttagtttgtt-agatg |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
35986290 |
cacttcactagaagaaaatagaagtgtctagtatatattttatgtttctttttcgtagtaaaaattatta-ttttttaaataatttagtttgttcagata |
35986388 |
T |
 |
Q |
100 |
caactatatataaaa |
114 |
Q |
|
|
|||||||||| |||| |
|
|
T |
35986389 |
caactatataaaaaa |
35986403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 131 - 177
Target Start/End: Original strand, 35986135 - 35986181
Alignment:
Q |
131 |
aaattaattcttcatattttgcgggattcaaataaacggaatcaaat |
177 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
35986135 |
aaattaattcttcatattttgtgggattcaaataaacggaatcaaat |
35986181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 197 - 237
Target Start/End: Original strand, 35986254 - 35986294
Alignment:
Q |
197 |
agaaaaaaccacttttttagcaatctaaattcgacacactt |
237 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
35986254 |
agaaaaaaccacttttttagcaatccaaattcgacacactt |
35986294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 360980 times since January 2019
Visitors: 487