View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_13_65 (Length: 236)

Name: J5_13_65
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_13_65
J5_13_65
[»] chr3 (4 HSPs)
chr3 (123-236)||(35986290-35986403)
chr3 (60-106)||(35986135-35986181)
chr3 (1-42)||(35986253-35986294)
chr3 (120-159)||(10297251-10297291)


Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 35986403 - 35986290
Alignment:
123 ttttatatatagttgtatct-aacaaactaaattatttnnnnnnntaataatttttactacgaaaaagaaacataaaatagatactagacacttctattt 221  Q
    |||| ||||||||||||||| |||||||||||||||||       ||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
35986403 ttttttatatagttgtatctgaacaaactaaattatttaaaaaa-taataatttttactacgaaaaagaaacataaaatatatactagacacttctattt 35986305  T
222 tcttctagtgaagtg 236  Q
    |||||||||||||||    
35986304 tcttctagtgaagtg 35986290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 60 - 106
Target Start/End: Complemental strand, 35986181 - 35986135
Alignment:
60 atttgattccgtttatttgaatcccgcaaaatatgaagaattaattt 106  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||    
35986181 atttgattccgtttatttgaatcccacaaaatatgaagaattaattt 35986135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 35986294 - 35986253
Alignment:
1 aagtgtgtcgaatttagattgctaaaaaagtggttttttctt 42  Q
    ||||||||||||||| ||||||||||||||||||||||||||    
35986294 aagtgtgtcgaatttggattgctaaaaaagtggttttttctt 35986253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 159
Target Start/End: Original strand, 10297251 - 10297291
Alignment:
120 cccttttatatatagttgtat-ctaacaaactaaattattt 159  Q
    ||||||||||||||||||||| | |||||||||||||||||    
10297251 cccttttatatatagttgtatccaaacaaactaaattattt 10297291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108437 times since January 2019
Visitors: 1329