View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_02 (Length: 153)

Name: J5_14_02
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_02
J5_14_02
[»] chr7 (1 HSPs)
chr7 (1-130)||(21969900-21970030)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 21969900 - 21970030
Alignment:
1 tggaggactaagttgatacaggtcttcattttcaatgatnnnnnnn-tttaggtattaactcaattttaacaagttgcaaaaactncctctttcacatga 99  Q
    |||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||| ||||||||||||||    
21969900 tggaggactaagttgatacaggtcttcattttcaatgataaaaaaaatttaggtattaactcaattttaacaagttgcaaaaactacctctttcacatga 21969999  T
100 gtgctatgatccattgtgagctgaagaggat 130  Q
    |||||||||||||||||||||||||||||||    
21970000 gtgctatgatccattgtgagctgaagaggat 21970030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 203244 times since January 2019
Visitors: 1517