View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_10 (Length: 123)

Name: J5_14_10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_10
J5_14_10
[»] chr4 (1 HSPs)
chr4 (1-123)||(38899577-38899699)


Alignment Details
Target: chr4 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 38899699 - 38899577
Alignment:
1 ccaatcgaattaaataattggataatgaaacctgttcctcttcacatcacatgatcaacacatgtaatcatacaaatgtatatataccaaaattcatcga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38899699 ccaatcgaattaaataattggataatgaaacctgttcctcttcacatcacatgatcaacacatgtaatcatacaaatgtatatataccaaaattcatcga 38899600  T
101 ttcactgtccctacataacatgc 123  Q
    |||||||||||||||||||||||    
38899599 ttcactgtccctacataacatgc 38899577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360517 times since January 2019
Visitors: 484