View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_17 (Length: 97)

Name: J5_14_17
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_17
J5_14_17
[»] chr2 (2 HSPs)
chr2 (1-97)||(33242910-33243006)
chr2 (1-97)||(33250830-33250926)
[»] scaffold0128 (1 HSPs)
scaffold0128 (1-97)||(40417-40513)
[»] chr4 (1 HSPs)
chr4 (1-93)||(44985921-44986013)
[»] chr1 (1 HSPs)
chr1 (15-97)||(25606833-25606915)


Alignment Details
Target: chr2 (Bit Score: 94; Significance: 2e-46; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 33242910 - 33243006
Alignment:
1 tatgatacttaatgtggatggtagtagtctcggtaatctcgacgtttcaggatttagagggttgatccgaaattctgacggtgcntggattcagggg 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
33242910 tatgatacttaatgtggatggtagtagtctcggtaatctcgacgtttcaggatttagagggttgatccgaaattctgacggtgcatggattcagggg 33243006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 58; E-Value: 6e-25
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 33250830 - 33250926
Alignment:
1 tatgatacttaatgtggatggtagtagtctcggtaatctcgacgtttcaggatttagagggttgatccgaaattctgacggtgcntggattcagggg 97  Q
    ||||||||| ||||| |||| ||||||||||||||||| || | ||||||| |||||| ||||||||||||||||||||||||| |||||| |||||    
33250830 tatgatactgaatgtagatgatagtagtctcggtaatcccgccatttcaggctttagacggttgatccgaaattctgacggtgcatggatttagggg 33250926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0128 (Bit Score: 58; Significance: 6e-25; HSPs: 1)
Name: scaffold0128
Description:

Target: scaffold0128; HSP #1
Raw Score: 58; E-Value: 6e-25
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 40513 - 40417
Alignment:
1 tatgatacttaatgtggatggtagtagtctcggtaatctcgacgtttcaggatttagagggttgatccgaaattctgacggtgcntggattcagggg 97  Q
    ||||||| | |||||||||||||||||||| ||||||| || ||||||||| ||| |||||||||||||||||||| | ||||| ||||||||||||    
40513 tatgatattgaatgtggatggtagtagtcttggtaatcacggcgtttcaggctttggagggttgatccgaaattctaatggtgcttggattcagggg 40417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 50; Significance: 3e-20; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 44985921 - 44986013
Alignment:
1 tatgatacttaatgtggatggtagtagtctcggtaatctcgacgtttcaggatttagagggttgatccgaaattctgacggtgcntggattca 93  Q
    ||||||| | |||||||| |||||||||||||||||||  ||||||||| | ||||||| |||||||||||||||| | ||||| ||||||||    
44985921 tatgatattgaatgtggacggtagtagtctcggtaatcctgacgtttcaagctttagagagttgatccgaaattctaatggtgcatggattca 44986013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 15 - 97
Target Start/End: Complemental strand, 25606915 - 25606833
Alignment:
15 tggatggtagtagtctcggtaatctcgacgtttcaggatttagagggttgatccgaaattctgacggtgcntggattcagggg 97  Q
    |||||||||||||||||| ||||| |   |||||||| ||| |||||||||||| ||||||||| ||||| ||||||||||||    
25606915 tggatggtagtagtctcgataatcccagtgtttcaggctttggagggttgatccaaaattctgatggtgcatggattcagggg 25606833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110941 times since January 2019
Visitors: 1335