View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_69 (Length: 328)

Name: J5_14_69
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_69
J5_14_69
[»] chr6 (2 HSPs)
chr6 (1-303)||(852763-853065)
chr6 (293-328)||(853061-853096)


Alignment Details
Target: chr6 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 303
Target Start/End: Complemental strand, 853065 - 852763
Alignment:
1 gctcggttgaacaccttcacacgagacctcacaactatgtgagtgacttttaggtggtggttgacactgtctacataagagaaaatgatgattgattttg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
853065 gctcggttgaacaccttcacacgagacctcacaactatgtgagtgacttttaggtggtggttgacactgtctacataagagaaaataatgattgattttg 852966  T
101 atcaaaattaaannnnnnngagattaaatttaattcgacaatgtatcaaaaataaacttagaagtttgagtttgatattgctaggctggacaatgttacc 200  Q
    ||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
852965 atcaaaattaaatttttttgagattaaatttaattcgacaatgtatcaaaaataaacttagaagtttgagtttgatattgctaggctggacaatgttacc 852866  T
201 tgcgacctcacaatgtgtgattgagtttcgggtagtagttgccactttgtctatagacnnnnnnnnttgtttgatttgattgcaacaacttgatagatta 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||    
852865 tgcgacctcacaatgtgtgattgagtttcgggtagtagttgccactttgtctatagacaaaaaaaattgtttgatttgattgcaacaacttgatagatta 852766  T
301 att 303  Q
    |||    
852765 att 852763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 293 - 328
Target Start/End: Complemental strand, 853096 - 853061
Alignment:
293 atagattaattagaaatttgagctgcatattgctcg 328  Q
    ||||||||||||||||||||||||||||||||||||    
853096 atagattaattagaaatttgagctgcatattgctcg 853061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110633 times since January 2019
Visitors: 1335