View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_71 (Length: 657)

Name: J5_14_71
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_71
J5_14_71
[»] chr1 (37 HSPs)
chr1 (324-657)||(51826348-51826681)
chr1 (1-331)||(51826677-51827004)
chr1 (553-657)||(4289172-4289276)
chr1 (146-245)||(19007562-19007661)
chr1 (112-245)||(48203350-48203482)
chr1 (570-657)||(28039183-28039270)
chr1 (575-657)||(42055307-42055389)
chr1 (150-245)||(42657716-42657811)
chr1 (146-251)||(27198267-27198372)
chr1 (112-245)||(48194592-48194724)
chr1 (137-245)||(19893453-19893561)
chr1 (146-245)||(43553538-43553637)
chr1 (171-251)||(35679369-35679449)
chr1 (165-244)||(8141363-8141442)
chr1 (581-654)||(19007349-19007422)
chr1 (115-186)||(14229004-14229074)
chr1 (168-244)||(9577670-9577746)
chr1 (590-657)||(27198510-27198577)
chr1 (108-182)||(4288998-4289071)
chr1 (165-244)||(6312460-6312539)
chr1 (165-244)||(9322735-9322814)
chr1 (165-244)||(15835288-15835367)
chr1 (165-244)||(25612043-25612122)
chr1 (204-245)||(31622712-31622753)
chr1 (153-222)||(14555301-14555370)
chr1 (165-221)||(18798400-18798456)
chr1 (599-654)||(19894190-19894245)
chr1 (198-245)||(39881195-39881242)
chr1 (146-245)||(28039390-28039489)
chr1 (165-220)||(29219198-29219253)
chr1 (165-220)||(29396623-29396678)
chr1 (624-654)||(48194832-48194862)
chr1 (624-654)||(48203590-48203620)
chr1 (146-184)||(52179674-52179712)
chr1 (137-186)||(8416410-8416459)
chr1 (165-223)||(28387628-28387686)
chr1 (165-242)||(42290732-42290809)
[»] chr2 (23 HSPs)
chr2 (454-657)||(18176111-18176314)
chr2 (1-251)||(18176310-18176557)
chr2 (327-460)||(18175950-18176083)
chr2 (568-654)||(15284282-15284369)
chr2 (132-245)||(3858155-3858268)
chr2 (564-654)||(2085787-2085877)
chr2 (568-621)||(2288635-2288688)
chr2 (589-651)||(43022682-43022743)
chr2 (146-245)||(2288463-2288560)
chr2 (165-225)||(378892-378952)
chr2 (168-260)||(24776233-24776325)
chr2 (168-240)||(32125148-32125220)
chr2 (571-654)||(42863311-42863394)
chr2 (165-244)||(26788678-26788757)
chr2 (165-244)||(28844449-28844528)
chr2 (168-225)||(20605065-20605122)
chr2 (112-187)||(37981682-37981756)
chr2 (165-221)||(215462-215518)
chr2 (165-221)||(3463588-3463644)
chr2 (112-190)||(7488079-7488156)
chr2 (165-223)||(28740520-28740578)
chr2 (204-253)||(29940939-29940988)
chr2 (165-222)||(33135539-33135596)
[»] chr3 (32 HSPs)
chr3 (474-657)||(45215063-45215246)
chr3 (1-251)||(45215242-45215489)
chr3 (327-469)||(45214836-45214978)
chr3 (146-232)||(10104997-10105083)
chr3 (146-232)||(10216144-10216230)
chr3 (146-232)||(10225773-10225859)
chr3 (592-657)||(34292293-34292358)
chr3 (557-654)||(44041790-44041887)
chr3 (112-190)||(46749308-46749385)
chr3 (581-651)||(12103172-12103242)
chr3 (146-190)||(10225652-10225696)
chr3 (165-244)||(10660427-10660506)
chr3 (165-244)||(31646519-31646598)
chr3 (204-253)||(10067725-10067774)
chr3 (146-190)||(10104876-10104920)
chr3 (146-190)||(10216023-10216067)
chr3 (165-244)||(36674365-36674444)
chr3 (116-185)||(44041999-44042067)
chr3 (146-244)||(44701546-44701645)
chr3 (146-183)||(10055767-10055804)
chr3 (171-236)||(6035293-6035358)
chr3 (165-222)||(23753621-23753678)
chr3 (168-225)||(44762275-44762332)
chr3 (165-221)||(11431441-11431497)
chr3 (165-221)||(27240478-27240534)
chr3 (165-221)||(44906748-44906804)
chr3 (201-244)||(50901212-50901255)
chr3 (165-221)||(54628758-54628814)
chr3 (165-220)||(18749486-18749541)
chr3 (204-257)||(36055048-36055101)
chr3 (146-183)||(45926928-45926965)
chr3 (204-245)||(50900488-50900529)
[»] chr6 (14 HSPs)
chr6 (515-656)||(31609396-31609537)
chr6 (568-654)||(5957371-5957457)
chr6 (143-245)||(31609672-31609774)
chr6 (146-245)||(5957128-5957227)
chr6 (112-245)||(7100166-7100298)
chr6 (112-245)||(8794332-8794464)
chr6 (112-231)||(708931-709049)
chr6 (581-654)||(709156-709229)
chr6 (165-244)||(31895588-31895667)
chr6 (165-244)||(34773301-34773380)
chr6 (577-640)||(10009348-10009411)
chr6 (624-654)||(7100406-7100436)
chr6 (624-654)||(8794194-8794224)
chr6 (165-244)||(14262667-14262746)
[»] chr7 (40 HSPs)
chr7 (541-657)||(37649424-37649541)
chr7 (515-656)||(34115176-34115317)
chr7 (553-657)||(28421949-28422052)
chr7 (41-245)||(37649576-37649776)
chr7 (41-244)||(42678073-42678275)
chr7 (142-245)||(26201541-26201643)
chr7 (108-244)||(34115419-34115554)
chr7 (553-657)||(41060225-41060329)
chr7 (599-657)||(46201057-46201115)
chr7 (112-245)||(46037300-46037432)
chr7 (575-654)||(46037113-46037192)
chr7 (142-221)||(15913390-15913469)
chr7 (148-245)||(3634215-3634312)
chr7 (147-220)||(21066809-21066882)
chr7 (168-244)||(509585-509661)
chr7 (165-244)||(7993029-7993108)
chr7 (165-236)||(37327822-37327893)
chr7 (204-254)||(44623505-44623555)
chr7 (172-255)||(47914149-47914232)
chr7 (147-245)||(5572538-5572636)
chr7 (165-223)||(48117827-48117885)
chr7 (570-654)||(48399931-48400020)
chr7 (165-221)||(29614998-29615054)
chr7 (165-244)||(18838276-18838355)
chr7 (165-244)||(28342234-28342313)
chr7 (165-220)||(39028008-39028063)
chr7 (146-188)||(41060044-41060086)
chr7 (165-244)||(41827201-41827280)
chr7 (562-592)||(42677970-42678000)
chr7 (165-223)||(23101206-23101264)
chr7 (625-654)||(32630940-32630969)
chr7 (621-654)||(42678002-42678035)
chr7 (625-654)||(48545633-48545662)
chr7 (146-190)||(9599048-9599092)
chr7 (146-190)||(9826619-9826663)
chr7 (165-222)||(9882470-9882527)
chr7 (168-225)||(10676615-10676672)
chr7 (168-221)||(29893033-29893086)
chr7 (168-221)||(43187580-43187633)
chr7 (172-245)||(47879061-47879134)
[»] scaffold0472 (2 HSPs)
scaffold0472 (562-654)||(1635-1727)
scaffold0472 (41-245)||(1765-1967)
[»] chr5 (22 HSPs)
chr5 (560-652)||(36682139-36682231)
chr5 (575-654)||(2275966-2276047)
chr5 (562-652)||(40460329-40460419)
chr5 (146-232)||(26795616-26795702)
chr5 (146-232)||(26806680-26806766)
chr5 (590-654)||(28594219-28594283)
chr5 (590-657)||(9689123-9689190)
chr5 (92-186)||(39753496-39753588)
chr5 (146-244)||(2276188-2276286)
chr5 (146-190)||(26806559-26806603)
chr5 (590-654)||(27786445-27786509)
chr5 (146-190)||(28594425-28594469)
chr5 (146-245)||(9689319-9689418)
chr5 (168-254)||(6460675-6460761)
chr5 (146-190)||(26795495-26795539)
chr5 (165-244)||(4550491-4550570)
chr5 (165-244)||(14000339-14000418)
chr5 (204-245)||(27786212-27786253)
chr5 (109-158)||(36681984-36682032)
chr5 (146-190)||(378290-378334)
chr5 (165-221)||(37013830-37013886)
chr5 (204-253)||(6902692-6902741)
[»] chr4 (30 HSPs)
chr4 (132-245)||(44646723-44646836)
chr4 (557-643)||(44646965-44647051)
chr4 (553-657)||(53272148-53272252)
chr4 (112-255)||(28100532-28100675)
chr4 (112-257)||(38230762-38230906)
chr4 (108-245)||(53271911-53272047)
chr4 (570-657)||(16653493-16653580)
chr4 (132-185)||(36094278-36094331)
chr4 (165-245)||(37915676-37915756)
chr4 (165-244)||(5441296-5441375)
chr4 (165-244)||(30967534-30967613)
chr4 (112-245)||(41761981-41762114)
chr4 (146-253)||(53594080-53594187)
chr4 (165-244)||(54341036-54341115)
chr4 (146-244)||(28847085-28847183)
chr4 (148-245)||(16653256-16653353)
chr4 (168-225)||(32951074-32951131)
chr4 (146-186)||(37370870-37370910)
chr4 (168-244)||(20021236-20021312)
chr4 (172-244)||(23987148-23987220)
chr4 (165-221)||(37828637-37828693)
chr4 (146-188)||(1848510-1848552)
chr4 (108-185)||(20538993-20539070)
chr4 (165-244)||(27767948-27768027)
chr4 (165-244)||(28483875-28483954)
chr4 (624-654)||(38231014-38231044)
chr4 (577-651)||(47301553-47301627)
chr4 (168-251)||(55302728-55302811)
chr4 (625-654)||(5117204-5117233)
chr4 (165-223)||(49835048-49835106)
[»] chr8 (12 HSPs)
chr8 (592-657)||(14061785-14061850)
chr8 (108-190)||(14061603-14061684)
chr8 (600-651)||(39038909-39038962)
chr8 (165-244)||(14782369-14782448)
chr8 (165-244)||(32497376-32497455)
chr8 (165-244)||(44726044-44726123)
chr8 (108-182)||(39039066-39039140)
chr8 (172-253)||(42937244-42937325)
chr8 (165-221)||(39467701-39467757)
chr8 (165-244)||(4031492-4031571)
chr8 (165-244)||(10295615-10295694)
chr8 (146-186)||(24317972-24318012)
[»] scaffold0287 (1 HSPs)
scaffold0287 (148-245)||(11773-11870)
[»] scaffold1504 (1 HSPs)
scaffold1504 (165-244)||(756-835)
[»] scaffold0543 (1 HSPs)
scaffold0543 (165-244)||(10453-10532)
[»] scaffold0042 (1 HSPs)
scaffold0042 (165-244)||(58269-58348)
[»] scaffold0347 (1 HSPs)
scaffold0347 (165-221)||(14811-14867)
[»] scaffold0306 (1 HSPs)
scaffold0306 (168-221)||(13840-13893)
[»] scaffold0152 (1 HSPs)
scaffold0152 (168-221)||(21434-21487)


Alignment Details
Target: chr1 (Bit Score: 313; Significance: 1e-176; HSPs: 37)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 324 - 657
Target Start/End: Original strand, 51826348 - 51826681
Alignment:
324 aattaataaattagaaaacaaattgactttnnnnnnntttacacatgaatctgcaattttgaaatacaagcatcagtatgtaacgtggacaacaaccttc 423  Q
    ||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51826348 aattaataaattagaaaacaaattgactttaaaaaaatttacacatgaatctgcaattttgaaatacaagcatcagtatgtaacgtggacaacaaccttc 51826447  T
424 ttaactggaacgagcacatcaacaatgagaagcaataatataaaaaattaaaagtgtacggtgtgaaattggaataattacgttgaaggagagtagaggc 523  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51826448 ttaactggaacgagcacatcaacaatgagaagcaataatataaaaaattaaaagtgtacggtgtgaaattggaataattacgttgaaggagagtagaggc 51826547  T
524 tatgactctgagggcaagagacaaggatgaaacaaaagttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtg 623  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51826548 tatgactctgagggcaagagacaaggatgaaacaaaagttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtg 51826647  T
624 tatttttaactaaaaagtctcacaaaatccactc 657  Q
    ||||||||||||||||||||||||||||||||||    
51826648 tatttttaactaaaaagtctcacaaaatccactc 51826681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 51826677 - 51827004
Alignment:
1 cactctacaatagaatccattaaaatctcaagannnnnnnaataccaatagacattttataagttactataaattctcaaatgatgccatgggaattgat 100  Q
    |||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||    
51826677 cactctacaatagaatccattaaaatctcaagatttttttaataccaatagacattttataagttactataaat-ctcaattgatgccatgggaattgat 51826775  T
101 tgccctggaataaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnatt 200  Q
    |||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||    
51826776 tgccttg-aataaaaaatcttgattgtctt-gattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagatttttttatt 51826873  T
201 attaaaaagtcttttaaaatcccttcaaatcttaattcaatacactctccttagtttatttctcaccatcatcaatgcaaacttatacatggtaattatc 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51826874 attaaaaagtcttttaaaatcccttcaaatcttaattcaatacactctccttagtttatttctcaccatcatcaatgcaaacttatacatggtaattatc 51826973  T
301 agagggacacattgggaaaaaagaattaata 331  Q
    |||||||||||||||||||||||||||||||    
51826974 agagggacacattgggaaaaaagaattaata 51827004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 553 - 657
Target Start/End: Complemental strand, 4289276 - 4289172
Alignment:
553 aaacaaaagttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatc 652  Q
    |||||||| |||||   ||||| |||||||| |||| | |||||||||||||||||| ||||| | ||||||||||||| ||||||| ||||||||||||    
4289276 aaacaaaaattatgggagtctctaaaagtctgaaggatatttgtgagattgttgaataagcatcttatgtgtatttttagctaaaaattctcacaaaatc 4289177  T
653 cactc 657  Q
    |||||    
4289176 cactc 4289172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 146 - 245
Target Start/End: Original strand, 19007562 - 19007661
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||| ||||  |||||||||||||||||||||||||||| |||       ||||| |||||||||||||||||||||| |||||| ||||||||||||    
19007562 agatttgtttacattttataaaagtcttgattgaataccactagactttttcattataaaaaagtcttttaaaatcccttgaaatctcaattcaatacac 19007661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 112 - 245
Target Start/End: Complemental strand, 48203482 - 48203350
Alignment:
112 aaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtc 211  Q
    ||||| || |||||||||| |||| |||| ||  |||||| ||||| |||||||||||||||||||||||||||| |||       ||| | ||||||||    
48203482 aaaaagtcatgattgtctt-gattgaataccacaagatttgtttatattttataaaagtcttgattgaataccactagactttttcattctaaaaaagtc 48203384  T
212 ttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||||| |||||  ||||||||||||    
48203383 ttttaaaatcccttgaaatcccaattcaatacac 48203350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 570 - 657
Target Start/End: Original strand, 28039183 - 28039270
Alignment:
570 gtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatccactc 657  Q
    ||||||||||||||||||  | ||||||||||||||||||||| |  | |||||||||||||| |||||||| ||||||||| |||||    
28039183 gtctcaaaaagtctcaagaatatttgtgagattgttgaatgagtacgttatgtgtatttttaattaaaaagtttcacaaaattcactc 28039270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 575 - 657
Target Start/End: Complemental strand, 42055389 - 42055307
Alignment:
575 aaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatccactc 657  Q
    |||||||||  ||||||||| ||||||||||||||||| |||| ||||||||||||||||||||| | |  ||||||||||||    
42055389 aaaaagtcttgaggttttttttgagattgttgaatgagtattttatgtgtatttttaactaaaaatttttgcaaaatccactc 42055307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 150 - 245
Target Start/End: Complemental strand, 42657811 - 42657716
Alignment:
150 ttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||| |||||| |||||||||||||||||||||||||       || ||||||||||||||||||||| ||| |||||| ||| ||||||||    
42657811 ttatttatattttatgaaagtcttgattgaataccacaagacttttttataattaaaaagtcttttaaaatctcttgaaatctcaatccaatacac 42657716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 146 - 251
Target Start/End: Complemental strand, 27198372 - 27198267
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||| |||||||||||| |||||||||||||||||||       || |  |||||||||||||||||||||| || ||| ||| ||||||||    
27198372 agatttatttatattttataaaagttttgattgaataccacaagacttttttataaacaaaaagtcttttaaaatcccttaaagtctcaatccaatacac 27198273  T
246 tctcct 251  Q
     |||||    
27198272 cctcct 27198267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 112 - 245
Target Start/End: Complemental strand, 48194724 - 48194592
Alignment:
112 aaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtc 211  Q
    ||||| || |||||||||| |||| |||| ||  |||||| ||||  |||||||||||||||||||||||||||| |||       ||| | ||||||||    
48194724 aaaaagtcatgattgtctt-gattgaataccacaagatttgtttagattttataaaagtcttgattgaataccactagactttttcattctaaaaaagtc 48194626  T
212 ttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||||| |||||  ||||||||||||    
48194625 ttttaaaatcccttgaaatcccaattcaatacac 48194592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 137 - 245
Target Start/End: Complemental strand, 19893561 - 19893453
Alignment:
137 aatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaat 236  Q
    |||| ||||||||||||| || || |||||||   ||||||||||||  |||||       || ||||||||||||||||||||||||| ||||||||||    
19893561 aataccatgagatttattaatattctataaaaaatttgattgaatactccaagatttttttatcattaaaaagtcttttaaaatcccttaaaatcttaat 19893462  T
237 tcaatacac 245  Q
    |||||||||    
19893461 tcaatacac 19893453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 146 - 245
Target Start/End: Complemental strand, 43553637 - 43553538
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||  ||||||||||||||| |||| |||||||||||       ||||| |||| |||| |||||||| ||| |||||||||||||||||||    
43553637 agatttatttaaattttataaaagtcttaattgtataccacaagacttttttattatgaaaatgtctattaaaatctcttgaaatcttaattcaatacac 43553538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 171 - 251
Target Start/End: Original strand, 35679369 - 35679449
Alignment:
171 cttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacactctcct 251  Q
    ||||||||||||||||||||       ||||| |||||||||||||||||||||| ||||| | ||||||||||| |||||    
35679369 cttgattgaataccacaagactttttcattataaaaaagtcttttaaaatcccttaaaatcatgattcaatacaccctcct 35679449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 8141363 - 8141442
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| ||||||||||||    
8141363 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaattcaataca 8141442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 581 - 654
Target Start/End: Original strand, 19007349 - 19007422
Alignment:
581 tctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    |||||||| ||| ||||||||||||| |||||  | | || | |||||||||||||||||||||||||||||||    
19007349 tctcaagggtttgtgtgagattgttggatgagagtattatttatatttttaactaaaaagtctcacaaaatcca 19007422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 186
Target Start/End: Original strand, 14229004 - 14229074
Alignment:
115 aaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccac 186  Q
    ||||| ||||||||||  |||||||| || ||||||| ||| | ||||||||||||||||||||||||||||    
14229004 aaatcatgattgtctta-attcaataccacgagatttctttgtattttataaaagtcttgattgaataccac 14229074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 168 - 244
Target Start/End: Original strand, 9577670 - 9577746
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||| |       || |||||||||||||||||||||||||| |||| |||| |||||||    
9577670 agtcttgattgaataccacaaaactttttcatcattaaaaagtcttttaaaatcccttcgaatcctaatccaataca 9577746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 590 - 657
Target Start/End: Complemental strand, 27198577 - 27198510
Alignment:
590 tttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatccactc 657  Q
    ||||||||||||||||||||||| ||||  |   ||||||||||||| ||||||||||||||| ||||    
27198577 tttttgtgagattgttgaatgagtattttgttcatatttttaactaagaagtctcacaaaatcaactc 27198510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 108 - 182
Target Start/End: Complemental strand, 4289071 - 4288998
Alignment:
108 gaataaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaata 182  Q
    ||||||||| ||||||||||||| |||| |||| ||   ||||||||||| || |||||||||||||||||||||    
4289071 gaataaaaagtcttgattgtctt-gattgaataccacatgatttatttatattctataaaagtcttgattgaata 4288998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 6312539 - 6312460
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
6312539 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 6312460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 9322735 - 9322814
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
9322735 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 9322814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 15835288 - 15835367
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
15835288 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 15835367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 25612122 - 25612043
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
25612122 aaaagtcttgattgaataccacaagattttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 25612043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 204 - 245
Target Start/End: Original strand, 31622712 - 31622753
Alignment:
204 aaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    ||||| |||||||||||||||||||||| |||||||||||||    
31622712 aaaaaatcttttaaaatcccttcaaatcataattcaatacac 31622753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 153 - 222
Target Start/End: Original strand, 14555301 - 14555370
Alignment:
153 tttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcc 222  Q
    ||||| |||||||||||||||||||||||||||| | |       ||||| |||||||||||||||||||    
14555301 tttatattttataaaagtcttgattgaataccaccaaacttttttattataaaaaagtcttttaaaatcc 14555370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 18798456 - 18798400
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||    
18798456 aaaagtcttgattgaataccacaagacattttcataattaaaaagtcttttaaaatc 18798400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 599 - 654
Target Start/End: Complemental strand, 19894245 - 19894190
Alignment:
599 gattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    ||||||||||||| ||| ||| ||||||||| ||||||||||| | ||||||||||    
19894245 gattgttgaatgatcatgtcacgtgtattttcaactaaaaagttttacaaaatcca 19894190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 198 - 245
Target Start/End: Original strand, 39881195 - 39881242
Alignment:
198 attattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    ||||||||||||||||||||||||  || || ||||||||||||||||    
39881195 attattaaaaagtcttttaaaatcatttgaagtcttaattcaatacac 39881242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 146 - 245
Target Start/End: Original strand, 28039390 - 28039489
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||| |||||||||||| || |||||||| | |||||       ||| ||||||| ||||||| |||||| | |||||| |||| |||||||    
28039390 agatttatttatattttataaaagttttaattgaatatctcaagacctttttatttttaaaaattcttttataatcccatgaaatctcaattgaatacac 28039489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 220
Target Start/End: Complemental strand, 29219253 - 29219198
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaat 220  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||    
29219253 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaat 29219198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 220
Target Start/End: Original strand, 29396623 - 29396678
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaat 220  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||    
29396623 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaat 29396678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 624 - 654
Target Start/End: Complemental strand, 48194862 - 48194832
Alignment:
624 tatttttaactaaaaagtctcacaaaatcca 654  Q
    |||||||||||||||||||||||||||||||    
48194862 tatttttaactaaaaagtctcacaaaatcca 48194832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 624 - 654
Target Start/End: Complemental strand, 48203620 - 48203590
Alignment:
624 tatttttaactaaaaagtctcacaaaatcca 654  Q
    |||||||||||||||||||||||||||||||    
48203620 tatttttaactaaaaagtctcacaaaatcca 48203590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 146 - 184
Target Start/End: Original strand, 52179674 - 52179712
Alignment:
146 agatttatttatgttttataaaagtcttgattgaatacc 184  Q
    |||||||||||| ||||||||||||||| ||||||||||    
52179674 agatttatttatattttataaaagtctttattgaatacc 52179712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 186
Target Start/End: Original strand, 8416410 - 8416459
Alignment:
137 aatatcatgagatttatttatgttttataaaagtcttgattgaataccac 186  Q
    |||||||| ||| |||||||| |||||| ||||||||||||||| |||||    
8416410 aatatcataagacttatttattttttattaaagtcttgattgaacaccac 8416459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 165 - 223
Target Start/End: Original strand, 28387628 - 28387686
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatccc 223  Q
    ||||||||||||||||||||| ||||       || |||||||||||||||||||||||    
28387628 aaaagtcttgattgaataccataagactttttcataattaaaaagtcttttaaaatccc 28387686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 165 - 242
Target Start/End: Complemental strand, 42290809 - 42290732
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaata 242  Q
    |||||| |||||||||||||||||||       || |||||||| |||||||||||||| |  ||||||||| |||||    
42290809 aaaagttttgattgaataccacaagactttttcataattaaaaaatcttttaaaatcccatagaatcttaatccaata 42290732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 180; Significance: 7e-97; HSPs: 23)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 7e-97
Query Start/End: Original strand, 454 - 657
Target Start/End: Original strand, 18176111 - 18176314
Alignment:
454 agcaataatataaaaaattaaaagtgtacggtgtgaaattggaataattacgttgaaggagagtagaggctatgactctgagggcaagagacaaggatga 553  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||    
18176111 agcaataatataaaaacttaaaagtgtacggtgtgaaattggaataattacgttgaaggagagtagaggctatgactctaagggtaagagacaaggatga 18176210  T
554 aacaaaagttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcc 653  Q
    ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
18176211 aacgaaagttgtgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatatcatgtgtatttttaactaaaaagtctcacaaaatcc 18176310  T
654 actc 657  Q
    ||||    
18176311 actc 18176314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 137; E-Value: 3e-71
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 18176310 - 18176557
Alignment:
1 cactctacaatagaatccattaaaatctcaagannnnnnnaataccaatagacattttataagttactataaattctcaaatga-tgccatgggaattga 99  Q
    |||||||||||||||||||||||||||||||||       ||||||||||||||||||||||| |  |||||| |||||| ||| | |||||||||||||    
18176310 cactctacaatagaatccattaaaatctcaagaattttg-aataccaatagacattttataagatt-tataaaatctcaattgaataccatgggaattga 18176407  T
100 ttgccctggaataaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnat 199  Q
    ||||| || |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||       ||    
18176408 ttgccttg-aataaaaaatcttgattgtctt-gattcaataccatgagatttatttatgttttataaaagtcttgattgaataccacaagatttttttat 18176505  T
200 tattaaaaagtcttttaaaatcccttcaaatcttaattcaatacactctcct 251  Q
    ||||||||| |||||||||||||||||||||||||||||||||||| |||||    
18176506 tattaaaaaatcttttaaaatcccttcaaatcttaattcaatacaccctcct 18176557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 327 - 460
Target Start/End: Original strand, 18175950 - 18176083
Alignment:
327 taataaattagaaaacaaattgactttnnnnnnntttacacatgaatctgcaattttgaaatacaagcatcagtatgtaacgtggacaacaaccttctta 426  Q
    |||||||||||||||||||||||||||       |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||     
18175950 taataaattagaaaacaaattgactttaaaaaaatttacacatgaatctggaattttgaaatataagcatcagtatgtaacgtggacaacaaccttcttg 18176049  T
427 actggaacgagcacatcaacaatgagaagcaata 460  Q
    ||||||||||||||||||||||||||||||||||    
18176050 actggaacgagcacatcaacaatgagaagcaata 18176083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 568 - 654
Target Start/End: Original strand, 15284282 - 15284369
Alignment:
568 atgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagt-ctcacaaaatcca 654  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||    
15284282 atgtctcaaaaagtcttaaggttttttgtgagattgttgaatgagcatgtcatgtgtatttttaactaaaaagtactcacaaaatcca 15284369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 132 - 245
Target Start/End: Original strand, 3858155 - 3858268
Alignment:
132 gattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatc 231  Q
    |||| ||||||||||||||||||||| || |||||||||||||||||||||||| || |       || ||||||||||||||||||||||||| |||||    
3858155 gattgaatatcatgagatttatttatattctataaaagtcttgattgaataccaaaaaagttttttatcattaaaaagtcttttaaaatcccttaaaatc 3858254  T
232 ttaattcaatacac 245  Q
    ||||||||||||||    
3858255 ttaattcaatacac 3858268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 564 - 654
Target Start/End: Complemental strand, 2085877 - 2085787
Alignment:
564 atgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    ||||| |||| |||||||| ||||||||| | |||||||||||| ||| ||| ||||||||||||| || |||||||||||||||||||||    
2085877 atgaaagtcttaaaaagtcacaaggttttctatgagattgttgattgaacatatcatgtgtattttcaaataaaaagtctcacaaaatcca 2085787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 568 - 621
Target Start/End: Complemental strand, 2288688 - 2288635
Alignment:
568 atgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatg 621  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||| |||||    
2288688 atgtctcaaaaagtttcaaggttttttgtgagattgttgaatgagcatatcatg 2288635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 589 - 651
Target Start/End: Complemental strand, 43022743 - 43022682
Alignment:
589 ttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaat 651  Q
    ||||||| ||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||    
43022743 ttttttgagagattgttgaatgatcatatcatgtgtatttttaactaaaaa-tctcacaaaat 43022682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 146 - 245
Target Start/End: Complemental strand, 2288560 - 2288463
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||| ||||  |||||||||||||||||||||||||||| |||       || || |||||||||||||||||||||| || ||| ||||||||||||    
2288560 agatttgtttacattttataaaagtcttgattgaataccactagactttt--ataataaaaaagtcttttaaaatcccttgaattctcaattcaatacac 2288463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 165 - 225
Target Start/End: Complemental strand, 378952 - 378892
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatccctt 225  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||||||    
378952 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatccctt 378892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 168 - 260
Target Start/End: Complemental strand, 24776325 - 24776233
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacactctccttagtttatt 260  Q
    |||||||||||||||||||||||       || || ||||||||||||||||||||||  |||| | || |||||||| | ||||||||||||    
24776325 agtcttgattgaataccacaagactttttcatgataaaaaagtcttttaaaatcccttagaatcatgatccaatacaccccccttagtttatt 24776233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 168 - 240
Target Start/End: Complemental strand, 32125220 - 32125148
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaa 240  Q
    |||||||||||||||||||||||       ||||| |||||||||||||||||||||| ||||| | ||||||    
32125220 agtcttgattgaataccacaagactttttcattataaaaaagtcttttaaaatcccttaaaatcatgattcaa 32125148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 571 - 654
Target Start/End: Complemental strand, 42863394 - 42863311
Alignment:
571 tctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    |||| |||||||||||  |||||||||||||||| |||||| ||| | |||| ||||||||| ||| || ||| ||||||||||    
42863394 tctcgaaaagtctcaatattttttgtgagattgtagaatgaacatgttatgtatatttttaattaagaactcttacaaaatcca 42863311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 26788757 - 26788678
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
26788757 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 26788678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 28844528 - 28844449
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
28844528 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 28844449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 168 - 225
Target Start/End: Complemental strand, 20605122 - 20605065
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatccctt 225  Q
    |||||||||||||||||||||||       || |||||||||||||||||||||||||    
20605122 agtcttgattgaataccacaagactttttcatgattaaaaagtcttttaaaatccctt 20605065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 112 - 187
Target Start/End: Complemental strand, 37981756 - 37981682
Alignment:
112 aaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccaca 187  Q
    |||||||| ||||||||||  ||| |||| ||  | |||||||||| |||||||||||| ||||||||||||||||    
37981756 aaaaaatcatgattgtctta-attgaataccacaaaatttatttatattttataaaagttttgattgaataccaca 37981682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Original strand, 215462 - 215518
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||    
215462 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatc 215518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 3463644 - 3463588
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||    
3463644 aaaagtcttgattgaataccacaagattttttcataattaaaaagtcttttaaaatc 3463588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 112 - 190
Target Start/End: Original strand, 7488079 - 7488156
Alignment:
112 aaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaaga 190  Q
    ||||| |||| |||||||| |||| |||| ||  |||||||||||  ||| ||||||||||||||| ||||||||||||    
7488079 aaaaagtcttaattgtctt-gattgaataccacaagatttatttagatttcataaaagtcttgattcaataccacaaga 7488156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 165 - 223
Target Start/End: Original strand, 28740520 - 28740578
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatccc 223  Q
    |||||| |||||||||||||||||||       || |||||||||||||||||||||||    
28740520 aaaagttttgattgaataccacaagactttttcataattaaaaagtcttttaaaatccc 28740578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 204 - 253
Target Start/End: Complemental strand, 29940988 - 29940939
Alignment:
204 aaaaagtcttttaaaatcccttcaaatcttaattcaatacactctcctta 253  Q
    ||||||||||||||||||| || |||||| ||| |||||||| |||||||    
29940988 aaaaagtcttttaaaatcctttgaaatctcaatccaatacaccctcctta 29940939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 165 - 222
Target Start/End: Complemental strand, 33135596 - 33135539
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcc 222  Q
    ||||||||||||||||||||| ||||       || ||||||||||||||||||||||    
33135596 aaaagtcttgattgaataccataagactttttcataattaaaaagtcttttaaaatcc 33135539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 164; Significance: 3e-87; HSPs: 32)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 164; E-Value: 3e-87
Query Start/End: Original strand, 474 - 657
Target Start/End: Original strand, 45215063 - 45215246
Alignment:
474 aaagtgtacggtgtgaaattggaataattacgttgaaggagagtagaggctatgactctgagggcaagagacaaggatgaaacaaaagttatgaatgtct 573  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||||||    
45215063 aaagtgtacggtgtgaaattggaataattacgttgaaggagagtagaggctatgactgtgagggtaagagacaaggatgaaacaaaagttgtgaatgtct 45215162  T
574 caaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatccactc 657  Q
    |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||    
45215163 caaaaagtctcaaggttttttgtgagattgttgaatgagcatctcaggtgtatttttaactaaaaagtctcacaaaatccactc 45215246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 125; E-Value: 5e-64
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 45215242 - 45215489
Alignment:
1 cactctacaatagaatccattaaaatctcaagannnnnnnaataccaatagacattttataagttactataaattctcaaatga-tgccatgggaattga 99  Q
    ||||||||||| ||||| |||||||||||||||       ||||||||||||||||||||||||| ||| |||  ||||| ||| | |||||||||||||    
45215242 cactctacaattgaatctattaaaatctcaagatttttg-aataccaatagacattttataagttgctacaaaa-ctcaattgaataccatgggaattga 45215339  T
100 ttgccctggaataaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnat 199  Q
    ||||| || |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||       ||    
45215340 ttgccttg-aataaaaaatcttgattgtctt-gattcaataccatgagatttatttatgttttataaaagttttgattgaataccacaagatttttttat 45215437  T
200 tattaaaaagtcttttaaaatcccttcaaatcttaattcaatacactctcct 251  Q
    |||||||||||||||||||||||||||||||||||||| ||||||| |||||    
45215438 tattaaaaagtcttttaaaatcccttcaaatcttaatttaatacaccctcct 45215489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 98; E-Value: 6e-48
Query Start/End: Original strand, 327 - 469
Target Start/End: Original strand, 45214836 - 45214978
Alignment:
327 taataaattagaaaacaaattgactttnnnnnnntttacacatgaatctgcaattttgaaatacaagcatcagtatgtaacgtggacaacaaccttctta 426  Q
    ||||||||||||||| |||||||||||       ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||     
45214836 taataaattagaaaataaattgactttaaaaaaatttacacatgaatctgcaattttgaaatacaagtatcactatgtaacgtggacaacaaccttcttg 45214935  T
427 actggaacgagcacatcaacaatgagaagcaataatataaaaa 469  Q
    ||||||| |||||||||||||||||||| ||||||||||||||    
45214936 actggaatgagcacatcaacaatgagaaacaataatataaaaa 45214978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 146 - 232
Target Start/End: Original strand, 10104997 - 10105083
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatct 232  Q
    |||||||||||| ||||||||||||||||||||||||||||||||       || || |||||||||||||||||||||| ||||||    
10104997 agatttatttatattttataaaagtcttgattgaataccacaagatttttttataataaaaaagtcttttaaaatcccttgaaatct 10105083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 146 - 232
Target Start/End: Original strand, 10216144 - 10216230
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatct 232  Q
    |||||||||||| ||||||||||||||||||||||||||||||||       || || ||||| |||||||||||||||| ||||||    
10216144 agatttatttatattttataaaagtcttgattgaataccacaagacttttttataataaaaaaatcttttaaaatccctttaaatct 10216230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 146 - 232
Target Start/End: Original strand, 10225773 - 10225859
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatct 232  Q
    |||||||||||| |||||||||||||||||||||||| |||||||       || || |||||||||||||||||||||| ||||||    
10225773 agatttatttatattttataaaagtcttgattgaatagcacaagacttttttataataaaaaagtcttttaaaatcccttgaaatct 10225859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 592 - 657
Target Start/End: Original strand, 34292293 - 34292358
Alignment:
592 tttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatccactc 657  Q
    |||||||||||||||||||||||| | |||||||||||||  |||||| |||||||||||||||||    
34292293 tttgtgagattgttgaatgagcatcttatgtgtatttttagttaaaaaatctcacaaaatccactc 34292358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 557 - 654
Target Start/End: Original strand, 44041790 - 44041887
Alignment:
557 aaaagttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    |||| ||||||| |||||| ||||||||| |||||| | ||||||||||||| ||| || | ||||||||||| |||||||||||||||  |||||||    
44041790 aaaaattatgaaagtctcagaaagtctcatggttttctttgagattgttgaaagagtatgttatgtgtattttcaactaaaaagtctcatgaaatcca 44041887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 112 - 190
Target Start/End: Complemental strand, 46749385 - 46749308
Alignment:
112 aaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaaga 190  Q
    |||||||||||||||||||  ||| |||| ||| |||||||||||| ||||||||||||||||||| | ||||||||||    
46749385 aaaaaatcttgattgtctta-attgaataccataagatttatttatattttataaaagtcttgattcattaccacaaga 46749308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 581 - 651
Target Start/End: Original strand, 12103172 - 12103242
Alignment:
581 tctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaat 651  Q
    |||||||| | |||||||||| ||||||||||||| | |||||||||||||  ||||||||||||||||||    
12103172 tctcaaggatatttgtgagatcgttgaatgagcatgttatgtgtatttttagttaaaaagtctcacaaaat 12103242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 146 - 190
Target Start/End: Original strand, 10225652 - 10225696
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaaga 190  Q
    |||||||||||| ||||||||||||||||||||||||||||||||    
10225652 agatttatttatattttataaaagtcttgattgaataccacaaga 10225696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 10660506 - 10660427
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  ||||||||| |||||||    
10660506 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcttaatccaataca 10660427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 31646519 - 31646598
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| ||||||||||||    
31646519 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaattcaataca 31646598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 204 - 253
Target Start/End: Original strand, 10067725 - 10067774
Alignment:
204 aaaaagtcttttaaaatcccttcaaatcttaattcaatacactctcctta 253  Q
    |||||||||||||||||||||| |||||| |||||||||||| |||||||    
10067725 aaaaagtcttttaaaatcccttgaaatctcaattcaatacaccctcctta 10067774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 190
Target Start/End: Original strand, 10104876 - 10104920
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaaga 190  Q
    |||||||||||| |||||||||||| |||||||||||||||||||    
10104876 agatttatttatattttataaaagttttgattgaataccacaaga 10104920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 190
Target Start/End: Original strand, 10216023 - 10216067
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaaga 190  Q
    |||||||||||| |||||||||||| |||||||||||||||||||    
10216023 agatttatttatattttataaaagttttgattgaataccacaaga 10216067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 36674365 - 36674444
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
36674365 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 36674444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 116 - 185
Target Start/End: Original strand, 44041999 - 44042067
Alignment:
116 aatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaatacca 185  Q
    |||||||||||||||  ||| |||| ||  |||||||||||| || ||||||||||||||||||||||||    
44041999 aatcttgattgtctta-attgaataccacaagatttatttatattctataaaagtcttgattgaatacca 44042067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 146 - 244
Target Start/End: Complemental strand, 44701645 - 44701546
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaa-gtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    |||||| ||||  |||||||||||||||||||||||| ||| |||       ||||| ||||| ||||||||||||||||| || ||| |||||||||||    
44701645 agatttgtttacattttataaaagtcttgattgaatatcactagacattttcattataaaaaatgtcttttaaaatcccttgaattctcaattcaataca 44701546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 146 - 183
Target Start/End: Original strand, 10055767 - 10055804
Alignment:
146 agatttatttatgttttataaaagtcttgattgaatac 183  Q
    |||||||||||| |||||||||||||||||||||||||    
10055767 agatttatttatattttataaaagtcttgattgaatac 10055804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 171 - 236
Target Start/End: Original strand, 6035293 - 6035358
Alignment:
171 cttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaat 236  Q
    ||||||||||||||||||||       || ||||||||||||||||||||||| | ||||||||||    
6035293 cttgattgaataccacaagattttttcataattaaaaagtcttttaaaatcccataaaatcttaat 6035358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 165 - 222
Target Start/End: Original strand, 23753621 - 23753678
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcc 222  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||    
23753621 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcc 23753678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 168 - 225
Target Start/End: Original strand, 44762275 - 44762332
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatccctt 225  Q
    |||||||||||||||||||||||       ||||| ||||||||||||||||||||||    
44762275 agtcttgattgaataccacaagactttttcattataaaaaagtcttttaaaatccctt 44762332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 11431497 - 11431441
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||    
11431497 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatc 11431441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Original strand, 27240478 - 27240534
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||    
27240478 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatc 27240534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Original strand, 44906748 - 44906804
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||    
44906748 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatc 44906804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 201 - 244
Target Start/End: Original strand, 50901212 - 50901255
Alignment:
201 attaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||| |||| ||||| |||||||    
50901212 attaaaaagtcttttaaaatcccttaaaattttaatccaataca 50901255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 54628814 - 54628758
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||    
54628814 aaaagtcttgattgaataccacaagacgttttcataattaaaaagtcttttaaaatc 54628758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 220
Target Start/End: Complemental strand, 18749541 - 18749486
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaat 220  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||    
18749541 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaat 18749486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 204 - 257
Target Start/End: Original strand, 36055048 - 36055101
Alignment:
204 aaaaagtcttttaaaatcccttcaaatcttaattcaatacactctccttagttt 257  Q
    ||||||||||||||||||| || |||||| ||| |||||||| | |||||||||    
36055048 aaaaagtcttttaaaatcctttgaaatctcaatccaatacaccccccttagttt 36055101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 146 - 183
Target Start/End: Original strand, 45926928 - 45926965
Alignment:
146 agatttatttatgttttataaaagtcttgattgaatac 183  Q
    |||||||||||| ||||||| |||||||||||||||||    
45926928 agatttatttatattttatagaagtcttgattgaatac 45926965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 204 - 245
Target Start/End: Original strand, 50900488 - 50900529
Alignment:
204 aaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    ||||||||||||||||||| || |||||||||| ||||||||    
50900488 aaaaagtcttttaaaatcctttgaaatcttaatccaatacac 50900529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 90; Significance: 4e-43; HSPs: 14)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 515 - 656
Target Start/End: Original strand, 31609396 - 31609537
Alignment:
515 agtagaggctatgactctgagggcaagagacaaggatgaaacaaaagttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagca 614  Q
    |||||||||||||| | || ||| | || |||| ||  |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||    
31609396 agtagaggctatgattgtgggggtatgaaacaaagacaaaacaaaagttatggatgtctcaaaaagtctcaaggttttttatgagattgttgaatgagca 31609495  T
615 tttcatgtgtatttttaactaaaaagtctcacaaaatccact 656  Q
    | ||||||||||||| ||||||||||||||||||||||||||    
31609496 tgtcatgtgtattttcaactaaaaagtctcacaaaatccact 31609537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 568 - 654
Target Start/End: Complemental strand, 5957457 - 5957371
Alignment:
568 atgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||    
5957457 atgtctcaaaaagtctcaaggttttttgtgagattattgaatgagcatatcatgtgtatttttaactaaaaagtctcacaaaatcca 5957371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 143 - 245
Target Start/End: Original strand, 31609672 - 31609774
Alignment:
143 atgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaata 242  Q
    ||||||||||||||| || |||||||||||||||||||||||||||||       || |||||||||||||||||||||| || ||| ||| ||||||||    
31609672 atgagatttatttatattctataaaagtcttgattgaataccacaagatttttttataattaaaaagtcttttaaaatccattgaaaacttcattcaata 31609771  T
243 cac 245  Q
    |||    
31609772 cac 31609774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 146 - 245
Target Start/End: Complemental strand, 5957227 - 5957128
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||| ||||  |||||||||||||||||||||||||||| |||       ||||| |||||||||||||||||||||| || ||| ||||||||||||    
5957227 agatttgtttacattttataaaagtcttgattgaataccactagacttttttattataaaaaagtcttttaaaatcccttgaattctcaattcaatacac 5957128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 112 - 245
Target Start/End: Complemental strand, 7100298 - 7100166
Alignment:
112 aaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtc 211  Q
    ||||| || |||||||||| |||| |||| ||  |||||| ||||  |||||||||||||||||||||||||||| |||       ||| | ||||||||    
7100298 aaaaagtcatgattgtctt-gattgaataccacaagatttgtttagattttataaaagtcttgattgaataccactagactttttcattctaaaaaagtc 7100200  T
212 ttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||||| |||||  ||||||||||||    
7100199 ttttaaaatcccttgaaatcccaattcaatacac 7100166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 112 - 245
Target Start/End: Original strand, 8794332 - 8794464
Alignment:
112 aaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtc 211  Q
    ||||| || |||||||||| |||| |||| ||  |||||| ||||  |||||||||||||||||||||||||||| |||       ||| | ||||||||    
8794332 aaaaagtcatgattgtctt-gattgaataccacaagatttgtttagattttataaaagtcttgattgaataccactagactttttcattctaaaaaagtc 8794430  T
212 ttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||||| |||||  ||||||||||||    
8794431 ttttaaaatcccttgaaatcccaattcaatacac 8794464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 112 - 231
Target Start/End: Complemental strand, 709049 - 708931
Alignment:
112 aaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtc 211  Q
    ||||| || |||||||||| |||| |||| ||  |||||||||||  |||||||||||| ||||||||||||||| |||       ||||| ||||||||    
709049 aaaaagtcatgattgtctt-gattgaataccacaagatttatttacattttataaaagttttgattgaataccactagattttttcattataaaaaagtc 708951  T
212 ttttaaaatcccttcaaatc 231  Q
    |||||||||||||| |||||    
708950 ttttaaaatcccttgaaatc 708931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 581 - 654
Target Start/End: Complemental strand, 709229 - 709156
Alignment:
581 tctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    |||||||| ||| ||||||||||||| |||||  | | || | |||||||||||||||||||||||||||||||    
709229 tctcaaggatttgtgtgagattgttggatgagagtattatttatatttttaactaaaaagtctcacaaaatcca 709156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 31895667 - 31895588
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
31895667 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 31895588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 34773380 - 34773301
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
34773380 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatataatcctaatccaataca 34773301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 577 - 640
Target Start/End: Original strand, 10009348 - 10009411
Alignment:
577 aaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaag 640  Q
    |||||||||| ||||| | | |||||||||| ||||||| | |||| |||||||||||||||||    
10009348 aaagtctcaacgttttctatcagattgttgattgagcatattatgtatatttttaactaaaaag 10009411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 624 - 654
Target Start/End: Complemental strand, 7100436 - 7100406
Alignment:
624 tatttttaactaaaaagtctcacaaaatcca 654  Q
    |||||||||||||||||||||||||||||||    
7100436 tatttttaactaaaaagtctcacaaaatcca 7100406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 624 - 654
Target Start/End: Original strand, 8794194 - 8794224
Alignment:
624 tatttttaactaaaaagtctcacaaaatcca 654  Q
    |||||||||||||||||||||||||||||||    
8794194 tatttttaactaaaaagtctcacaaaatcca 8794224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 14262667 - 14262746
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    |||| |||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
14262667 aaaaatcttgattgaataccacaagattttttcataattaaaaagtcttttaaaatcccgtagaatcctaatccaataca 14262746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 78; Significance: 5e-36; HSPs: 40)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 541 - 657
Target Start/End: Original strand, 37649424 - 37649541
Alignment:
541 gagacaaggatgaaacaaaagttatgaatgtctcaaaaagtctca-aggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaa 639  Q
    |||||||  ||||||||||| |||||||||||||||||||||||  || ||||||||||||||||||||| |||||||||||||| |||| |||||||||    
37649424 gagacaacaatgaaacaaaatttatgaatgtctcaaaaagtctcttagtttttttgtgagattgttgaattagcatttcatgtgttttttgaactaaaaa 37649523  T
640 gtctcacaaaatccactc 657  Q
    ||||||||||||||||||    
37649524 gtctcacaaaatccactc 37649541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 515 - 656
Target Start/End: Original strand, 34115176 - 34115317
Alignment:
515 agtagaggctatgactctgagggcaagagacaaggatgaaacaaaagttatgaatgtctcaaaaagtctcaaggtttt-ttgtgagattgttgaatgagc 613  Q
    |||||||||||||| |||| ||| | ||||||| ||  || ||||||||||| |||||||||||||| | |||||||| |||||||||||||||||||||    
34115176 agtagaggctatgattctg-gggtatgagacaaagacaaatcaaaagttatggatgtctcaaaaagttttaaggtttttttgtgagattgttgaatgagc 34115274  T
614 atttcatgtgtatttttaactaaaaagtctcacaaaatccact 656  Q
    || ||||||||||||| || |||||||||||||||||||||||    
34115275 atgtcatgtgtattttcaattaaaaagtctcacaaaatccact 34115317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 553 - 657
Target Start/End: Complemental strand, 28422052 - 28421949
Alignment:
553 aaacaaaagttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatc 652  Q
    |||||||||| ||||||||||| |||||||||| |||||| |||||||||||||||| || || ||||||||||||| ||||||||||| ||||||||||    
28422052 aaacaaaagtcatgaatgtctcgaaaagtctca-ggttttctgtgagattgttgaataagtatctcatgtgtattttcaactaaaaagtttcacaaaatc 28421954  T
653 cactc 657  Q
    |||||    
28421953 cactc 28421949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 41 - 245
Target Start/End: Original strand, 37649576 - 37649776
Alignment:
41 aataccaatagacattttataagttactataaattctcaaatga-tgccatgggaattgattgccctggaataaaaaatcttgattgtcttngattcaat 139  Q
    |||||||||||||||||||||||||  || |||| |||||  || | |||||||| ||| ||||| || ||||||||||||||||||| || |||| |||    
37649576 aataccaatagacattttataagttggtagaaat-ctcaatcgaataccatgggatttggttgccttg-aataaaaaatcttgattgtgtt-gattgaat 37649672  T
140 atcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattca 239  Q
    | ||||||||||| ||||||| |||||||||||| ||||||||||||  ||       || ||||||||||||||||||||| ||| |||||||||||||    
37649673 accatgagatttacttatgttctataaaagtctt-attgaataccac-cgaattttttatcattaaaaagtcttttaaaatctcttgaaatcttaattca 37649770  T
240 atacac 245  Q
    ||||||    
37649771 atacac 37649776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 41 - 244
Target Start/End: Original strand, 42678073 - 42678275
Alignment:
41 aataccaatagacattttataagttactataaattctcaaatga-tgccatgggaattgattgccctggaataaaaaa-tcttgattgtcttngattcaa 138  Q
    |||||||||||||||||||||||||  || |||| || || ||| | |||||| | ||| |||||||  ||||||||| ||||||||||||| |||| ||    
42678073 aataccaatagacattttataagttggtacaaat-cttaattgaataccatggaatttggttgccctc-aataaaaaagtcttgattgtctt-gattgaa 42678169  T
139 tatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattc 238  Q
    || |||||||||||||||||||| ||||||||||| |||||||| ||| |||       || ||||||||||||||||||||| ||| ||||||| ||||    
42678170 taccatgagatttatttatgtttcataaaagtcttaattgaatatcaccagatttttttatcattaaaaagtcttttaaaatctcttgaaatcttgattc 42678269  T
239 aataca 244  Q
    ||||||    
42678270 aataca 42678275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 142 - 245
Target Start/End: Original strand, 26201541 - 26201643
Alignment:
142 catgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaat 241  Q
    |||||||||||||||| ||||||||||||||||| |||||||||||| |       |  ||||||||||| ||||||||||||| |||||||||||||||    
26201541 catgagatttatttatattttataaaagtcttgaatgaataccacaatatatttttagcattaaaaagtc-tttaaaatcccttgaaatcttaattcaat 26201639  T
242 acac 245  Q
    ||||    
26201640 acac 26201643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 108 - 244
Target Start/End: Original strand, 34115419 - 34115554
Alignment:
108 gaataaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaa 207  Q
    ||||||||||  ||||| |||||  ||| |||| |||||||||||||||| ||  ||||||||||||||||||||| ||||||       || |||||||    
34115419 gaataaaaaaatttgatcgtctta-attgaataccatgagatttatttatattccataaaagtcttgattgaatactacaagatttttttatcattaaaa 34115517  T
208 agtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||  || |||| |||||||||||||    
34115518 agtcttttaaaatcatttgaaattttaattcaataca 34115554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 553 - 657
Target Start/End: Complemental strand, 41060329 - 41060225
Alignment:
553 aaacaaaagttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatc 652  Q
    |||||||| |||||   ||||| ||||||||||||  | |||||||||||||||||||| ||| | |||||||||||||  |||||||||| ||||||||    
41060329 aaacaaaaattatgggagtctctaaaagtctcaagaatatttgtgagattgttgaatgaacatgttatgtgtatttttagttaaaaagtcttacaaaatc 41060230  T
653 cactc 657  Q
    |||||    
41060229 cactc 41060225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 599 - 657
Target Start/End: Original strand, 46201057 - 46201115
Alignment:
599 gattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatccactc 657  Q
    ||||||||||| ||||||| |||||||||||||  ||||||||||||||||||||||||    
46201057 gattgttgaataagcattttatgtgtatttttagataaaaagtctcacaaaatccactc 46201115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 112 - 245
Target Start/End: Original strand, 46037300 - 46037432
Alignment:
112 aaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtc 211  Q
    ||||| || |||||||||| |||| |||||||  |||||| ||||  |||||||||||||||||||||||| ||| | |       ||||| ||||||||    
46037300 aaaaagtcatgattgtctt-gattgaatatcacaagatttgtttacattttataaaagtcttgattgaatatcactaaactttttaattataaaaaagtc 46037398  T
212 ttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||| | || ||| ||||||||||||    
46037399 ttttaaaatcccattaattctcaattcaatacac 46037432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 575 - 654
Target Start/End: Original strand, 46037113 - 46037192
Alignment:
575 aaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    ||||| |||||||| ||| ||||||||||||| |||||  | | || | |||||||||||||||||||||||||||||||    
46037113 aaaaaatctcaagggtttgtgtgagattgttggatgagagtattatttatatttttaactaaaaagtctcacaaaatcca 46037192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 142 - 221
Target Start/End: Original strand, 15913390 - 15913469
Alignment:
142 catgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    |||||||||||||||| || ||||||||||||||||||||| || ||||       ||||| ||||||||||||||||||    
15913390 catgagatttatttatattctataaaagtcttgattgaatatcataagatgtttttattatcaaaaagtcttttaaaatc 15913469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 245
Target Start/End: Complemental strand, 3634312 - 3634215
Alignment:
148 atttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    ||||| |||| |||||||||||||||||||||||| |||||||       || || |||||||||||||||||||||  |||||  ||| ||||||||    
3634312 atttacttatattttataaaagtcttgattgaatatcacaagacttttttataataaaaaagtcttttaaaatccctagaaatccgaatccaatacac 3634215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 220
Target Start/End: Complemental strand, 21066882 - 21066809
Alignment:
147 gatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaat 220  Q
    ||||||||||| || ||||||||||||||||||||||||||| |       ||| |||||||||||||||||||    
21066882 gatttatttatattctataaaagtcttgattgaataccacaaaacttttttatttttaaaaagtcttttaaaat 21066809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 168 - 244
Target Start/End: Complemental strand, 509661 - 509585
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    |||||||||||||||||||||||       || ||||||||||||||||||||||| | ||||| |||| |||||||    
509661 agtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccataaaatcctaatccaataca 509585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 7993108 - 7993029
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||  |  ||||||||| |||||||    
7993108 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcctatagaatcttaatccaataca 7993029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 236
Target Start/End: Complemental strand, 37327893 - 37327822
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaat 236  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||||||||    
37327893 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccattgaatcttaat 37327822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 204 - 254
Target Start/End: Original strand, 44623505 - 44623555
Alignment:
204 aaaaagtcttttaaaatcccttcaaatcttaattcaatacactctccttag 254  Q
    ||||| || |||||||||||||||||||||||| |||||||| ||||||||    
44623505 aaaaaatcgtttaaaatcccttcaaatcttaatccaatacaccctccttag 44623555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 172 - 255
Target Start/End: Complemental strand, 47914232 - 47914149
Alignment:
172 ttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacactctccttagt 255  Q
    |||||||||||||||||||       ||||| || |||||||||||||||||||  |||| | ||||||||||| |||||||||    
47914232 ttgattgaataccacaagactttttcattataaataagtcttttaaaatcccttagaatcatgattcaatacaccctccttagt 47914149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 245
Target Start/End: Original strand, 5572538 - 5572636
Alignment:
147 gatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    ||||||||||| |||||||||||||||||||||||| ||   ||       ||||| ||||||  ||||||||||| || |||||| ||||||||||||    
5572538 gatttatttatattttataaaagtcttgattgaatatcaatggacgtttttattataaaaaagcattttaaaatccattaaaatctcaattcaatacac 5572636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 223
Target Start/End: Original strand, 48117827 - 48117885
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatccc 223  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||||    
48117827 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatccc 48117885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 570 - 654
Target Start/End: Complemental strand, 48400020 - 48399931
Alignment:
570 gtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatt-----tttaactaaaaagtctcacaaaatcca 654  Q
    ||||| ||||||||||||| | ||||||||||||||||| |||  | | |||||||||     |||||||| ||||||||||||||||||    
48400020 gtctcgaaaagtctcaaggatatttgtgagattgttgaaggagtgtattatgtgtatttttattttaactagaaagtctcacaaaatcca 48399931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Original strand, 29614998 - 29615054
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||    
29614998 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatc 29615054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 18838355 - 18838276
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || |||||||||||||||| |||||| |  |||| |||| |||||||    
18838355 aaaagtcttgattgaataccacaagacattttcataattaaaaagtcttttataatcccatagaatcctaatccaataca 18838276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 28342313 - 28342234
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    |||| |||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
28342313 aaaaatcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 28342234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 220
Target Start/End: Complemental strand, 39028063 - 39028008
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaat 220  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||    
39028063 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaat 39028008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 146 - 188
Target Start/End: Complemental strand, 41060086 - 41060044
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaa 188  Q
    |||||||||||| ||| |||||| |||||||||||||||||||    
41060086 agatttatttatatttaataaaaatcttgattgaataccacaa 41060044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 41827280 - 41827201
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    |||| |||||||||||||||||||||       || ||||||||||||||||||||||| | ||||  |||| |||||||    
41827280 aaaattcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccataaaattctaatccaataca 41827201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 562 - 592
Target Start/End: Original strand, 42677970 - 42678000
Alignment:
562 ttatgaatgtctcaaaaagtctcaaggtttt 592  Q
    |||||||||||||||||||||||||||||||    
42677970 ttatgaatgtctcaaaaagtctcaaggtttt 42678000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 165 - 223
Target Start/End: Complemental strand, 23101264 - 23101206
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatccc 223  Q
    |||| |||||||||||||||||||||       || |||||||||||||||||||||||    
23101264 aaaattcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatccc 23101206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 625 - 654
Target Start/End: Complemental strand, 32630969 - 32630940
Alignment:
625 atttttaactaaaaagtctcacaaaatcca 654  Q
    ||||||||||||||||||||||||||||||    
32630969 atttttaactaaaaagtctcacaaaatcca 32630940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 621 - 654
Target Start/End: Original strand, 42678002 - 42678035
Alignment:
621 gtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    ||||||||||||||||||||||||| ||||||||    
42678002 gtgtatttttaactaaaaagtctcataaaatcca 42678035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 625 - 654
Target Start/End: Original strand, 48545633 - 48545662
Alignment:
625 atttttaactaaaaagtctcacaaaatcca 654  Q
    ||||||||||||||||||||||||||||||    
48545633 atttttaactaaaaagtctcacaaaatcca 48545662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 146 - 190
Target Start/End: Original strand, 9599048 - 9599092
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaaga 190  Q
    |||||||||||  |||||||||| |||||||||||||| ||||||    
9599048 agatttatttaaattttataaaattcttgattgaatactacaaga 9599092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 146 - 190
Target Start/End: Original strand, 9826619 - 9826663
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaaga 190  Q
    |||||||||||  |||||||||| |||||||||||||| ||||||    
9826619 agatttatttaaattttataaaattcttgattgaatactacaaga 9826663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 165 - 222
Target Start/End: Original strand, 9882470 - 9882527
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcc 222  Q
    ||||||||||||||||||||| ||||       || ||||||||||||||||||||||    
9882470 aaaagtcttgattgaataccataagactttttcataattaaaaagtcttttaaaatcc 9882527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 168 - 225
Target Start/End: Original strand, 10676615 - 10676672
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatccctt 225  Q
    |||||||||| ||||||||||||       || |||||||||||||||||||||||||    
10676615 agtcttgattaaataccacaagattttttcataattaaaaagtcttttaaaatccctt 10676672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 168 - 221
Target Start/End: Complemental strand, 29893086 - 29893033
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    |||||||||||||||||||||||       || |||||||||||||||||||||    
29893086 agtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatc 29893033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 43187580 - 43187633
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    |||||||||||||||||||||||       || |||||||||||||||||||||    
43187580 agtcttgattgaataccacaagactctttcataattaaaaagtcttttaaaatc 43187633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 172 - 245
Target Start/End: Complemental strand, 47879134 - 47879061
Alignment:
172 ttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||||||||||       ||||| || |||||||||||||||||||  |||| | |||||||||||    
47879134 ttgattgaataccacaagactttttcattataaataagtcttttaaaatcccttagaatcatgattcaatacac 47879061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0472 (Bit Score: 77; Significance: 2e-35; HSPs: 2)
Name: scaffold0472
Description:

Target: scaffold0472; HSP #1
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 562 - 654
Target Start/End: Original strand, 1635 - 1727
Alignment:
562 ttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||    
1635 ttatgaatgtttcaaaaagtctcaaggttttttgtgagattgttgaattagcatgtcaagtgtatttttaactaaaaagtctcacaaaatcca 1727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0472; HSP #2
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 41 - 245
Target Start/End: Original strand, 1765 - 1967
Alignment:
41 aataccaatagacattttataagttactataaattctcaaatga-tgccatgggaattgattgccctggaataaaaaatcttgattgtcttngattcaat 139  Q
    |||||||||||||||||||||||||  || |||| || || ||| | |||||||| ||| |||||||  |||||||| | ||||||||||| |||| |||    
1765 aataccaatagacattttataagttggtacaaat-cttaattgaataccatgggatttggttgccctc-aataaaaagttttgattgtctt-gattgaat 1861  T
140 atcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattca 239  Q
    |  || |||||||||||||||| |||||| |||| |||||||||||| | |       |||||||||||||||||||||||| ||| ||||||| |||||    
1862 actataagatttatttatgtttcataaaaatcttaattgaataccaccaaatttttttattattaaaaagtcttttaaaatctcttaaaatcttgattca 1961  T
240 atacac 245  Q
    ||||||    
1962 atacac 1967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 65; Significance: 3e-28; HSPs: 22)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 560 - 652
Target Start/End: Complemental strand, 36682231 - 36682139
Alignment:
560 agttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatc 652  Q
    ||||||| |||||| ||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||| ||||||    
36682231 agttatggatgtctgaaaaagtttcaaggttttttgtgagattgttgaataagcatgtcatgtgtattttcaactaaaaagtctcataaaatc 36682139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 575 - 654
Target Start/End: Original strand, 2275966 - 2276047
Alignment:
575 aaaaagtctcaaggtttt--ttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    ||||||| ||||||||||  ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||    
2275966 aaaaagtttcaaggttttttttgtgagattgttgaatgagcatgtcatgtgtatttttaactaaaaaatctcacaaaatcca 2276047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 562 - 652
Target Start/End: Original strand, 40460329 - 40460419
Alignment:
562 ttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatc 652  Q
    ||||||| |||||||||||| |||||||||||  |||||||||||||||| ||| | ||||||||||| |||||||||||||| |||||||    
40460329 ttatgaaagtctcaaaaagtttcaaggtttttcatgagattgttgaatgaacatgttatgtgtattttcaactaaaaagtctcgcaaaatc 40460419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 146 - 232
Target Start/End: Original strand, 26795616 - 26795702
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatct 232  Q
    |||||||||||| ||||||||||||||||||||||||||||||||       || || |||||||||||||||||||||| ||||||    
26795616 agatttatttatattttataaaagtcttgattgaataccacaagatttttttataataaaaaagtcttttaaaatcccttgaaatct 26795702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 146 - 232
Target Start/End: Original strand, 26806680 - 26806766
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatct 232  Q
    |||||||||||| |||||||||||||||||||||||| |||||||       || || |||||||||||||||||||||| ||||||    
26806680 agatttatttatattttataaaagtcttgattgaatatcacaagatttttttataataaaaaagtcttttaaaatcccttgaaatct 26806766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 590 - 654
Target Start/End: Original strand, 28594219 - 28594283
Alignment:
590 tttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    |||||||||||||||||||||||||||| ||    ||||||||||||||||||||||||||||||    
28594219 tttttgtgagattgttgaatgagcattttattcacatttttaactaaaaagtctcacaaaatcca 28594283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 590 - 657
Target Start/End: Original strand, 9689123 - 9689190
Alignment:
590 tttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatccactc 657  Q
    ||||||||||||||||||||||| ||||  | | |||||||||||||||||||||||||||| |||||    
9689123 tttttgtgagattgttgaatgagtattttgtttatatttttaactaaaaagtctcacaaaattcactc 9689190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 92 - 186
Target Start/End: Complemental strand, 39753588 - 39753496
Alignment:
92 ggaattgattgccctggaataaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccac 186  Q
    ||||||| |||||||| |||||||  || |||||||||| |||| |||||||  |||||| ||||| ||||||||||||||||||||||||||||    
39753588 ggaattggttgccctgaaataaaag-tcatgattgtctt-gattgaatatcacaagatttttttatattttataaaagtcttgattgaataccac 39753496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 146 - 244
Target Start/End: Original strand, 2276188 - 2276286
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    |||||||||||  |||||||||||||||||||||||||||| | |       ||||| |||||| ||||||||||||||| || ||| |||||||||||    
2276188 agatttatttacattttataaaagtcttgattgaataccactaaatttttttattataaaaaagacttttaaaatcccttgaattctcaattcaataca 2276286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 146 - 190
Target Start/End: Original strand, 26806559 - 26806603
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaaga 190  Q
    |||||||||||| ||||||||||||||||||||||||||||||||    
26806559 agatttatttatattttataaaagtcttgattgaataccacaaga 26806603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 590 - 654
Target Start/End: Complemental strand, 27786509 - 27786445
Alignment:
590 tttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatcca 654  Q
    ||||||||||||||||||||||||||||  |    ||||||||||||||||||||||||||||||    
27786509 tttttgtgagattgttgaatgagcattttgttcacatttttaactaaaaagtctcacaaaatcca 27786445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 146 - 190
Target Start/End: Original strand, 28594425 - 28594469
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaaga 190  Q
    ||||||||||||||||||||||| |||||||||||||||||||||    
28594425 agatttatttatgttttataaaaatcttgattgaataccacaaga 28594469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 146 - 245
Target Start/End: Original strand, 9689319 - 9689418
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||| |||||||||| ||||||||||||||| |||||       || |||||||| |||||||||||| ||| |||||| |||  |||||||    
9689319 agatttatttatattttataaaaatcttgattgaatacctcaagatttttttataattaaaaaatcttttaaaatctcttgaaatctaaatcaaatacac 9689418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 168 - 254
Target Start/End: Complemental strand, 6460761 - 6460675
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacactctccttag 254  Q
    |||||||||||||||||||||||       ||||| ||||| ||||||||||||||||  |||| | ||||||||||| ||||||||    
6460761 agtcttgattgaataccacaagactttttcattataaaaaaatcttttaaaatcccttagaatcatgattcaatacaccctccttag 6460675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 190
Target Start/End: Original strand, 26795495 - 26795539
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaaga 190  Q
    |||||||||||| |||||||||||| |||||||||||||||||||    
26795495 agatttatttatattttataaaagttttgattgaataccacaaga 26795539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 4550491 - 4550570
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
4550491 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 4550570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 14000339 - 14000418
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
14000339 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 14000418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 204 - 245
Target Start/End: Complemental strand, 27786253 - 27786212
Alignment:
204 aaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||||||||||||| |||||||||| ||||||||    
27786253 aaaaagtcttttaaaatcccttgaaatcttaatccaatacac 27786212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 109 - 158
Target Start/End: Complemental strand, 36682032 - 36681984
Alignment:
109 aataaaaaatcttgattgtcttngattcaatatcatgagatttatttatg 158  Q
    |||||||||||||||||||||| |||| |||| |||||||||||||||||    
36682032 aataaaaaatcttgattgtctt-gattgaataccatgagatttatttatg 36681984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 146 - 190
Target Start/End: Complemental strand, 378334 - 378290
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaaga 190  Q
    |||||||||||  ||||||| ||||||||||||||||||||||||    
378334 agatttatttagattttatagaagtcttgattgaataccacaaga 378290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 37013886 - 37013830
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||    
37013886 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatc 37013830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 204 - 253
Target Start/End: Original strand, 6902692 - 6902741
Alignment:
204 aaaaagtcttttaaaatcccttcaaatcttaattcaatacactctcctta 253  Q
    ||||||||||||||||||| | ||||||| ||| |||||||| |||||||    
6902692 aaaaagtcttttaaaatccttccaaatctcaatccaatacacactcctta 6902741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 65; Significance: 3e-28; HSPs: 30)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 132 - 245
Target Start/End: Complemental strand, 44646836 - 44646723
Alignment:
132 gattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatc 231  Q
    |||| |||| ||| |||||||||||||||||||||||||||||||||||||||||||||       || ||||||||||||||||||||| ||| |||||    
44646836 gattgaataccataagatttatttatgttttataaaagtcttgattgaataccacaagatttttttatcattaaaaagtcttttaaaatctcttgaaatc 44646737  T
232 ttaattcaatacac 245  Q
    || |||||||||||    
44646736 ttgattcaatacac 44646723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 557 - 643
Target Start/End: Complemental strand, 44647051 - 44646965
Alignment:
557 aaaagttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtct 643  Q
    |||| |||||||||||||||||||| ||||| |||| ||||||||| |||||||||||| |||||||||||||||||||||||||||    
44647051 aaaacttatgaatgtctcaaaaagtttcaagattttatgtgagattcttgaatgagcatgtcatgtgtatttttaactaaaaagtct 44646965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 553 - 657
Target Start/End: Complemental strand, 53272252 - 53272148
Alignment:
553 aaacaaaagttatgaatgtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatc 652  Q
    |||||||| |||||   ||||| ||||||||||||| | |||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||    
53272252 aaacaaaaattatgggagtctctaaaagtctcaaggatatttgtgagattgttgaataagcatgttatgtgtatttttagctaaaaagtctcacaaaatc 53272153  T
653 cactc 657  Q
    |||||    
53272152 cactc 53272148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 112 - 255
Target Start/End: Original strand, 28100532 - 28100675
Alignment:
112 aaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattat-taaaaagt 210  Q
    ||||| ||||||||||||| |||| |||| ||| |||||||||||| ||||||||||||||||||||||||||||||||       || ||  |||||||    
28100532 aaaaagtcttgattgtctt-gattgaataccataagatttatttatattttataaaagtcttgattgaataccacaagacttttttataataaaaaaagt 28100630  T
211 cttttaaaatcccttcaaatcttaattcaatacactctccttagt 255  Q
    ||||||||| ||||| |||||  ||| |||||||| | |||||||    
28100631 cttttaaaaccccttgaaatcccaatccaatacaccccccttagt 28100675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 112 - 257
Target Start/End: Complemental strand, 38230906 - 38230762
Alignment:
112 aaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtc 211  Q
    ||||| || |||||||||| |||| |||| ||  |||||| ||||  |||||||||||||||||||||||||||| |||       ||| | ||||||||    
38230906 aaaaagtcatgattgtctt-gattgaataccacaagatttgtttaaattttataaaagtcttgattgaataccactagactttttcattctaaaaaagtc 38230808  T
212 ttttaaaatcccttcaaatcttaattcaatacactctccttagttt 257  Q
    |||||||||||||| |||||  |||||||||||| | |||||||||    
38230807 ttttaaaatcccttgaaatcccaattcaatacaccccccttagttt 38230762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 108 - 245
Target Start/End: Complemental strand, 53272047 - 53271911
Alignment:
108 gaataaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaa 207  Q
    ||||||||| ||||||||||||| |||| |||| ||  | |||||||||| || ||||||||||||||||||||| |||||||       ||| | ||||    
53272047 gaataaaaagtcttgattgtctt-gattgaataccacaatatttatttatattatataaaagtcttgattgaatatcacaagacttttttattttaaaaa 53271949  T
208 agtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||||||| | |||||  ||||||||||||    
53271948 agtcttttaaaatcccatgaaatcccaattcaatacac 53271911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 570 - 657
Target Start/End: Complemental strand, 16653580 - 16653493
Alignment:
570 gtctcaaaaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatccactc 657  Q
    ||||||||||||||||||||||  ||||| ||||||||||||| || | |||| ||||||||| |||||||||||| ||||| |||||    
16653580 gtctcaaaaagtctcaaggtttaatgtgacattgttgaatgagtatgttatgtatatttttaagtaaaaagtctcataaaattcactc 16653493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 132 - 185
Target Start/End: Original strand, 36094278 - 36094331
Alignment:
132 gattcaatatcatgagatttatttatgttttataaaagtcttgattgaatacca 185  Q
    |||| |||||||| | ||||||||||||||||||||| ||||||||||||||||    
36094278 gattgaatatcataatatttatttatgttttataaaaatcttgattgaatacca 36094331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 165 - 245
Target Start/End: Complemental strand, 37915756 - 37915676
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| ||||||||    
37915756 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcataatccaatacac 37915676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 5441375 - 5441296
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
5441375 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 5441296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 30967534 - 30967613
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || |||||||| |||||||||||||| | ||||| |||| |||||||    
30967534 aaaagtcttgattgaataccacaagactttttcataattaaaaaatcttttaaaatcccataaaatcataatccaataca 30967613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 112 - 245
Target Start/End: Complemental strand, 41762114 - 41761981
Alignment:
112 aaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaa-gtcttgattgaataccacaagannnnnnnattattaaaaagt 210  Q
    ||||| ||||||||||||| | || |||| ||  ||| |||||||| |||||||||| ||||||||| ||||||||||||       || || | |||||    
41762114 aaaaagtcttgattgtcttag-ttgaataccacaagacttatttatattttataaaaagtcttgattcaataccacaagacttttttataatcacaaagt 41762016  T
211 cttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||| || |||||| ||| ||||||||    
41762015 cttttaaaatcctttaaaatctcaatccaatacac 41761981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 146 - 253
Target Start/End: Complemental strand, 53594187 - 53594080
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||||||||| |||||||||| | |||||||||| ||||||||       || || ||||||||||||||||| | || |||||| |||| |||| ||    
53594187 agatttatttatattttataaaatttttgattgaatgccacaagacttttctataataaaaaagtcttttaaaattcattgaaatctcaatttaatatac 53594088  T
246 tctcctta 253  Q
     |||||||    
53594087 cctcctta 53594080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 54341115 - 54341036
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
54341115 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 54341036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 146 - 244
Target Start/End: Original strand, 28847085 - 28847183
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||   ||| |||||||| ||||||||||||||| |||       ||||| ||||||||||||||||||| || |||||| ||| |||||||    
28847085 agatttattttcatttcataaaagttttgattgaataccactagacttttttattataaaaaagtcttttaaaatcctttaaaatctcaatccaataca 28847183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 148 - 245
Target Start/End: Complemental strand, 16653353 - 16653256
Alignment:
148 atttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    |||||| ||| |||||||||| |||||||||||||||||||||        || |||||| |||||||||||| || | |||||  ||||||||||||    
16653353 atttatgtatattttataaaattcttgattgaataccacaagacttttttttttttaaaatgtcttttaaaattccatgaaatcccaattcaatacac 16653256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 168 - 225
Target Start/End: Original strand, 32951074 - 32951131
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatccctt 225  Q
    |||||||||||||||||||||||       ||||| ||||||||||||||||||||||    
32951074 agtcttgattgaataccacaagactttttcattataaaaaagtcttttaaaatccctt 32951131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 146 - 186
Target Start/End: Original strand, 37370870 - 37370910
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccac 186  Q
    |||||||||||| |||||||||||| |||||||||||||||    
37370870 agatttatttatattttataaaagttttgattgaataccac 37370910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 168 - 244
Target Start/End: Complemental strand, 20021312 - 20021236
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    |||||||||| ||||||||||||       || ||||||||||||||||||||||||| ||||  |||| |||||||    
20021312 agtcttgattaaataccacaagactttttcataattaaaaagtcttttaaaatcccttaaaattataatccaataca 20021236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 172 - 244
Target Start/End: Complemental strand, 23987220 - 23987148
Alignment:
172 ttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    |||||||||||||||||||       || ||||||||||||||||||||||| | ||||| |||| |||||||    
23987220 ttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccataaaatcctaatccaataca 23987148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Original strand, 37828637 - 37828693
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||    
37828637 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatc 37828693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 146 - 188
Target Start/End: Original strand, 1848510 - 1848552
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccacaa 188  Q
    |||||||||||| ||||||||||||||||||| ||||| ||||    
1848510 agatttatttatattttataaaagtcttgattaaatacaacaa 1848552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 108 - 185
Target Start/End: Complemental strand, 20539070 - 20538993
Alignment:
108 gaataaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaa-gtcttgattgaatacca 185  Q
    ||||||||| |||| |||||||| |||| |||| ||  |||||||||||| |||| ||||| |||||||||||||||||    
20539070 gaataaaaagtcttaattgtctt-gattgaataccacaagatttatttatattttgtaaaaagtcttgattgaatacca 20538993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 27768027 - 27767948
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    |||| |||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
27768027 aaaaatcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 27767948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 28483954 - 28483875
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    |||||||||||||||||||| |||||       || ||||||||||||||||||||| | |  |||| ||||||||||||    
28483954 aaaagtcttgattgaatacctcaagactttttcataattaaaaagtcttttaaaatctcatagaatcctaattcaataca 28483875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 624 - 654
Target Start/End: Complemental strand, 38231044 - 38231014
Alignment:
624 tatttttaactaaaaagtctcacaaaatcca 654  Q
    |||||||||||||||||||||||||||||||    
38231044 tatttttaactaaaaagtctcacaaaatcca 38231014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 577 - 651
Target Start/End: Complemental strand, 47301627 - 47301553
Alignment:
577 aaagtctcaaggttttttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaat 651  Q
    |||||||| || |||||| |||||||||||| | |  || | ||||||||||| ||||||||||| |||||||||    
47301627 aaagtctcgagattttttatgagattgttgattaaatatgttatgtgtattttcaactaaaaagtttcacaaaat 47301553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 168 - 251
Target Start/End: Complemental strand, 55302811 - 55302728
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacactctcct 251  Q
    |||||||||||||||||| || |       ||||| |||||||||| ||||||||||| ||||| | ||||||||||| |||||    
55302811 agtcttgattgaataccataacactttttcattataaaaaagtcttctaaaatcccttaaaatcatgattcaatacaccctcct 55302728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 625 - 654
Target Start/End: Complemental strand, 5117233 - 5117204
Alignment:
625 atttttaactaaaaagtctcacaaaatcca 654  Q
    ||||||||||||||||||||||||||||||    
5117233 atttttaactaaaaagtctcacaaaatcca 5117204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 165 - 223
Target Start/End: Original strand, 49835048 - 49835106
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatccc 223  Q
    |||||| |||||||||||||||||||       || |||||||||||||||||||||||    
49835048 aaaagttttgattgaataccacaagactttttcataattaaaaagtcttttaaaatccc 49835106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 50; Significance: 3e-19; HSPs: 12)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 592 - 657
Target Start/End: Complemental strand, 14061850 - 14061785
Alignment:
592 tttgtgagattgttgaatgagcatttcatgtgtatttttaactaaaaagtctcacaaaatccactc 657  Q
    |||||||||||||||||| ||||| | ||||||||||||| |||||||||||||||||||||||||    
14061850 tttgtgagattgttgaataagcatgttatgtgtatttttagctaaaaagtctcacaaaatccactc 14061785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 108 - 190
Target Start/End: Complemental strand, 14061684 - 14061603
Alignment:
108 gaataaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttataaaagtcttgattgaataccacaaga 190  Q
    ||||||||| ||||||||||||| |||| |||| ||  |||||||||||| || ||||||| |||||||||||||||||||||    
14061684 gaataaaaagtcttgattgtctt-gattgaataccacaagatttatttatattctataaaaatcttgattgaataccacaaga 14061603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 600 - 651
Target Start/End: Original strand, 39038909 - 39038962
Alignment:
600 attgttgaatgagcatttcatgtgta--tttttaactaaaaagtctcacaaaat 651  Q
    ||||||||||||||||||||||||||  ||||||||||||||||||||||||||    
39038909 attgttgaatgagcatttcatgtgtatttttttaactaaaaagtctcacaaaat 39038962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 14782369 - 14782448
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
14782369 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 14782448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 32497455 - 32497376
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
32497455 aaaagtcttgattgaataccacaagactttttcatgattaaaaagtcttttaaaatcccatagaatcctaatccaataca 32497376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 44726044 - 44726123
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
44726044 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 44726123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 182
Target Start/End: Original strand, 39039066 - 39039140
Alignment:
108 gaataaaaaatcttgattgtcttngattcaatatcatgagatttatttatgttttata--aaagtcttgattgaata 182  Q
    ||||||||||||||||||||||| |||| |||| ||| |||||||||||| || ||||  |||||||||||||||||    
39039066 gaataaaaaatcttgattgtctt-gattgaataccat-agatttatttatattctataagaaagtcttgattgaata 39039140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 172 - 253
Target Start/End: Complemental strand, 42937325 - 42937244
Alignment:
172 ttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacactctcctta 253  Q
    |||||||||||||||||||       || || |||||||||||||||||||||| ||||| | || |||||||| |||||||    
42937325 ttgattgaataccacaagactttttcatgataaaaaagtcttttaaaatcccttaaaatcatgatccaatacaccctcctta 42937244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Original strand, 39467701 - 39467757
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||    
39467701 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatc 39467757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 4031492 - 4031571
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    |||||||||||| |||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
4031492 aaaagtcttgatcgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 4031571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 10295615 - 10295694
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || |||||||| |||||||||||||| |  |||| |||| |||||||    
10295615 aaaagtcttgattgaataccacaagactttttcataattaaaaactcttttaaaatcccatagaatcctaatccaataca 10295694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 146 - 186
Target Start/End: Complemental strand, 24318012 - 24317972
Alignment:
146 agatttatttatgttttataaaagtcttgattgaataccac 186  Q
    ||||| |||||| || |||||||||||||||||||||||||    
24318012 agattaatttatattatataaaagtcttgattgaataccac 24317972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0287 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0287
Description:

Target: scaffold0287; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 245
Target Start/End: Original strand, 11773 - 11870
Alignment:
148 atttatttatgttttataaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaatacac 245  Q
    ||||| |||| |||||||||||||||||||||||| |||||||       || || |||||||||||||||||||||  |||||  ||| ||||||||    
11773 atttacttatattttataaaagtcttgattgaatatcacaagacttttttataataaaaaagtcttttaaaatccctagaaatccgaatccaatacac 11870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1504 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold1504
Description:

Target: scaffold1504; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 835 - 756
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
835 aaaagtcttgattgaataccacaagaatttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0543 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0543
Description:

Target: scaffold0543; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 10532 - 10453
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
10532 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatagaatcctaatccaataca 10453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0042 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0042
Description:

Target: scaffold0042; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 58269 - 58348
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatcccttcaaatcttaattcaataca 244  Q
    ||||||||||||||||||||||||||       || ||||||||||||||||||||||| |  |||| |||| |||||||    
58269 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatcccatggaatcctaatccaataca 58348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0347
Description:

Target: scaffold0347; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 14867 - 14811
Alignment:
165 aaaagtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    ||||||||||||||||||||||||||       || |||||||||||||||||||||    
14867 aaaagtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatc 14811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0306 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0306
Description:

Target: scaffold0306; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 168 - 221
Target Start/End: Complemental strand, 13893 - 13840
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    |||||||||||||||||||||||       || |||||||||||||||||||||    
13893 agtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatc 13840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0152 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0152
Description:

Target: scaffold0152; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 21434 - 21487
Alignment:
168 agtcttgattgaataccacaagannnnnnnattattaaaaagtcttttaaaatc 221  Q
    |||||||||||||||||||||||       || |||||||||||||||||||||    
21434 agtcttgattgaataccacaagactttttcataattaaaaagtcttttaaaatc 21487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108142 times since January 2019
Visitors: 1329