View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_73 (Length: 654)

Name: J5_14_73
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_73
J5_14_73
[»] chr4 (1 HSPs)
chr4 (87-552)||(32258559-32259022)
[»] chr8 (1 HSPs)
chr8 (1-82)||(40568131-40568212)


Alignment Details
Target: chr4 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 87 - 552
Target Start/End: Complemental strand, 32259022 - 32258559
Alignment:
87 tcaccttcactgaagttaggatgtcctgaatccaaaactttagccactccaaatccatttataggctgcaaagttaacatccnaaagaaacaagtaaaac 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
32259022 tcaccttcactgaagttaggatgtcctgaatccaaaactttagccactccaaatccatttataggctgcaaagttaacatccaaaagaaacaagtaaaac 32258923  T
187 aaaattcaatgtatataagctcaagtgtttgtgtagtaccaaaataattcatcnnnnnnntataatattattaacttcttcatatttcatatatctatat 286  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||    
32258922 aaaattcaatgtatataagctcaagtgtttgtgtagtaccaaaataattcatcaaaaaaatataatattattaacttcttcatatttcatatatctatat 32258823  T
287 ttaggacaaatacttacagagccagggacgtaatagtgatatccagacataagaaattcatctttcctcatgaggaattgcatgactggatcacaagaaa 386  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32258822 ttaggacaaatacttacagagccagggacgtaatagtgatatccagacataagaaattcatctttcctcatgaggaattgcatgactggatcacaagaaa 32258723  T
387 ggnacaaattctcccccaaaacagcatttgatccttgaggaacctgaagctttatcttacttgtacttatgnanaaatccatcttcttgnaggntgccgt 486  Q
    || ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |||||||||| ||| |||| |    
32258722 ggtacaaattcttcaccaaaacagcatttgatccttgaggaacctgaagctttatcttacttgtacttatgtataaat-catcttcttgtaggttgccat 32258624  T
487 taacatagnccctgaatanaacttggttnggtctgaacgtcatcaacancggtgttctttcccatg 552  Q
    |||||||| || |||||| ||||| ||| | ||||||||||||||||| |||||||||||||||||    
32258623 taacatagtccttgaatataactt-gtttgttctgaacgtcatcaacaacggtgttctttcccatg 32258559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 82; Significance: 2e-38; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 40568212 - 40568131
Alignment:
1 atgataccattcattgagtgcgagacacacttcatatctttttgggtaaggtccaagtaccatatgctttttgtgcttgata 82  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40568212 atgataccattcattgagtgcgagacacacttcatatctttttgggtaaggtccaagtaccatatgctttttgtgcttgata 40568131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 314912 times since January 2019
Visitors: 446