View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_74 (Length: 474)

Name: J5_14_74
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_74
J5_14_74
[»] chr8 (2 HSPs)
chr8 (37-474)||(40567776-40568212)
chr8 (1-43)||(40568208-40568250)


Alignment Details
Target: chr8 (Bit Score: 417; Significance: 0; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 417; E-Value: 0
Query Start/End: Original strand, 37 - 474
Target Start/End: Original strand, 40567776 - 40568212
Alignment:
37 cattaatagcataatgtaaaacataanatatcgaaccccgcaaaccttcctcttcccatcagacttgcaagttgctcctaaaacaatgaattttaatgtt 136  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40567776 cattaatagcataatgtaaaacataaaatatcgaaccccgcaaaccttcctcttcccatcagacttgcaagttgctcctaaaacaatgaattttaatgtt 40567875  T
137 ttggtcataacataacataaatataagagaacaaattattgctcctctaatgctagcttatgtatgcagatattatatcatactaaacaacctattgaag 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40567876 ttggtcataacataacataaatataagagaacaaattattgctcctctaatgctagcttatgtatgcagatattatatcatactaaacaacctattgaag 40567975  T
237 taaagaccatttcagtgtttacggtctattatttcaacgctaataccttctagagcttatggtctatatattacctcaaaagtaaaaactaggtctaata 336  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40567976 taaagaccatttcagtgtttacggtctattatttcaacgctaataccttctagagcttatggtctatatattacctcaaaagtaaaaactaggtctaata 40568075  T
337 cattctagagcttacaatctcttgatcaacgtataataattatagtgtcgacttatatcaagcacnaaaagcatatggtaccttagaccttacccaaaaa 436  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||    
40568076 cattctagagcttacaatctcttgatcaacgtataataattatagtgtcgacttatatcaagcacaaaaagcatatggta-cttggaccttacccaaaaa 40568174  T
437 gatatgaagtgtgtctcgcactcaatgaatggnatcat 474  Q
    |||||||||||||||||||||||||||||||| |||||    
40568175 gatatgaagtgtgtctcgcactcaatgaatggtatcat 40568212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 40568208 - 40568250
Alignment:
1 atcatataatcctgtcttgaatacttcatcaggtctcattaat 43  Q
    |||||||||||||||||||||||||||||||||||||||||||    
40568208 atcatataatcctgtcttgaatacttcatcaggtctcattaat 40568250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 312237 times since January 2019
Visitors: 445