View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_76 (Length: 206)

Name: J5_14_76
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_76
J5_14_76
[»] chr3 (1 HSPs)
chr3 (1-199)||(49769852-49770050)
[»] chr6 (1 HSPs)
chr6 (9-169)||(3828667-3828828)


Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 49769852 - 49770050
Alignment:
1 cttaattntcaggctgaagcactagaaggccaggaaaccaacatagttacagattatataattaaggcagaaaatccagttcaccnaatttttaaagatg 100  Q
    ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||    
49769852 cttaattttcaggctgaagcactagaaggccaagaaaccaacatagttacagattatataattaaggtagaaaatccagttcatcaaatttttaaagatg 49769951  T
101 actttaggataaaataaggaagaatctcntttttctcctgttttaaaacattcggcanattttaggactanangnatgngcngataccntggtaggaga 199  Q
    |||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||| |||||||||||| | |  || || |||||| ||||||||||    
49769952 actttaggataaaataaggaagaatctcatttttttcctgttttaaaacatttggcagattttaggactagatgtttgtgctgataccatggtaggaga 49770050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 9 - 169
Target Start/End: Complemental strand, 3828828 - 3828667
Alignment:
9 tcaggctgaagcactagaaggccaggaaacc-aacatagttacagattatataattaaggcagaaaatccagttcaccnaatttttaaagatgactttag 107  Q
    ||||||||||||||||||||||||  ||| | ||||||||||||| |||||||||||||  |||||| | ||||||   | |||||| | |||| |||||    
3828828 tcaggctgaagcactagaaggccaaaaaaactaacatagttacaggttatataattaagctagaaaagcaagttcagaaattttttagaaatgattttag 3828729  T
108 gataaaataaggaagaatctcntttttctcctgttt-taaaacattcggcanattttaggact 169  Q
    ||||||||||||||||||||| ||||| | |||||| ||||||||| |||| |||||||||||    
3828728 gataaaataaggaagaatctcattttt-tactgtttctaaaacatttggcagattttaggact 3828667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360413 times since January 2019
Visitors: 483