View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_77 (Length: 166)

Name: J5_14_77
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_77
J5_14_77
[»] chr7 (1 HSPs)
chr7 (1-158)||(39189879-39190036)
[»] chr4 (1 HSPs)
chr4 (1-158)||(56232089-56232246)
[»] chr3 (1 HSPs)
chr3 (19-74)||(11096751-11096806)


Alignment Details
Target: chr7 (Bit Score: 158; Significance: 2e-84; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 158; E-Value: 2e-84
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 39189879 - 39190036
Alignment:
1 gttattatcatataataggaatccactaggatatattcatccacccacaacaaagttgaaaataaaacctgctccaagcatggcggtcttctcctctaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39189879 gttattatcatataataggaatccactaggatatattcatccacccacaacaaagttgaaaataaaacctgctccaagcatggcggtcttctcctctaga 39189978  T
101 gggcctaacacaatcacaccagagatcctcaaggtttgcctattctttcattattaat 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39189979 gggcctaacacaatcacaccagagatcctcaaggtttgcctattctttcattattaat 39190036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 134; Significance: 5e-70; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 134; E-Value: 5e-70
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 56232089 - 56232246
Alignment:
1 gttattatcatataataggaatccactaggatatattcatccacccacaacaaagttgaaaataaaacctgctccaagcatggcggtcttctcctctaga 100  Q
    |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  ||||||||||||    
56232089 gttattatcacataacaggaatccactaggatatattcatccacccacaacaaagttgaacataaaacctgctccaagcatggcggctttctcctctaga 56232188  T
101 gggcctaacacaatcacaccagagatcctcaaggtttgcctattctttcattattaat 158  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
56232189 gggcctaacccaatcacaccagagatcctcaaggtttgcctattctttcattattaat 56232246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 19 - 74
Target Start/End: Complemental strand, 11096806 - 11096751
Alignment:
19 gaatccactaggatatattcatccacccacaacaaagttgaaaataaaacctgctc 74  Q
    ||||||||||||||| |||||||||| | ||||||||||||  ||||| |||||||    
11096806 gaatccactaggatacattcatccactctcaacaaagttgagcataaagcctgctc 11096751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360002 times since January 2019
Visitors: 481