View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_83 (Length: 632)

Name: J5_14_83
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_83
J5_14_83
[»] chr4 (2 HSPs)
chr4 (163-623)||(53696009-53696466)
chr4 (1-168)||(53695808-53695975)


Alignment Details
Target: chr4 (Bit Score: 367; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 163 - 623
Target Start/End: Complemental strand, 53696466 - 53696009
Alignment:
163 attaatttcgcccatatgcaatctttgacgaaattaaacaatcgaatgtgtattgtattgcttgctactatacatagttatctacttgacgtcaaatcaa 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53696466 attaatttcgcccatatgcaatctttgacgaaattaaacaatcgaatgtgtattgtattgcttgctactatacatagttatctacttgacgtcaaatcaa 53696367  T
263 acattcctaaatagtaaatacaatgatgacggcactgtatgcaagaataatttgatgaattatttattttcctgccataaaatgggttgaaagttttcca 362  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
53696366 acattcctaaatagtaaatacaatgatgacggcactgtatgcaagaataatttgatgaattatttattttcctgccataaaatgggttgaaagtttccca 53696267  T
363 aaaataactcagtccgttcgaaacatcacattatatatgttgaaatcgaagtttaatggccagaatcttctacttatttatttnaaagtgaatttctaat 462  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
53696266 aaaataactcagtccgttcgaaacatcacattatatatgttgaaatcgaagtttaatggccagaatcttctacttatttattttaaagtgaatttctaat 53696167  T
463 cattaaantatctgacnnnnnnnntgaaatggccagaaaatctccaactcntggactcgggtanggtgtatatgcatttacatggctagaagaaaagntc 562  Q
    ||||||| ||||||||        ||||||||||||||||||| |||||| |||||||||||| ||||||||||||||||||||||||| ||||||| ||    
53696166 cattaaattatctgactaaaaaaatgaaatggccagaaaatct-caactcttggactcgggtaaggtgtatatgcatttacatggctag-agaaaagttc 53696069  T
563 acatgccnattaggaggggcncatttgccgagnccntantaatagttgggaaaaatatttg 623  Q
    ||||||| |||||||||| | ||||||| ||| |  || |||||||| |||||||||||||    
53696068 acatgcctattaggagggtcacatttgcagagtcagtaataatagtt-ggaaaaatatttg 53696009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 158; E-Value: 9e-84
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 53695975 - 53695808
Alignment:
1 ttatgaataaattaagactttagtatgtggttggatgagcgtttagaaaagcaaaaccgcgataaaaaacgacttttacacnccnacttttgattttcac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  || |||||||||||||||    
53695975 ttatgaataaattaagactttagtatgtggttggatgagcgtttagaaaagcaaaaccgcgataaaaaacgacttttacataccaacttttgattttcac 53695876  T
101 cgtggggaggctctcaaacctgagtttgcgcaagaaaatgtcaacccaaacaaatgctaagtattaat 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53695875 cgtggggaggctctcaaacctgagtttgcgcaagaaaatgtcaacccaaacaaatgctaagtattaat 53695808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108033 times since January 2019
Visitors: 1329