View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_85 (Length: 749)

Name: J5_14_85
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_85
J5_14_85
[»] chr2 (2 HSPs)
chr2 (1-348)||(40048975-40049322)
chr2 (341-638)||(40049568-40049865)
[»] chr1 (1 HSPs)
chr1 (566-638)||(40821945-40822017)
[»] chr5 (2 HSPs)
chr5 (566-633)||(6849710-6849778)
chr5 (566-625)||(2428560-2428620)
[»] chr7 (1 HSPs)
chr7 (566-638)||(34328758-34328831)
[»] chr6 (1 HSPs)
chr6 (593-633)||(29419997-29420037)


Alignment Details
Target: chr2 (Bit Score: 323; Significance: 0; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 1 - 348
Target Start/End: Complemental strand, 40049322 - 40048975
Alignment:
1 ttcggtccattgtacctacatccgataatagtgtttggtttcattttgatcaaacgttacttggagttacaagttataacatgagtttaaatactacgac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40049322 ttcggtccattgtacctacatccgataatagtgtttggtttcattttgatcaaacgttacttggagttacaagttataacatgagtttaaatactacgac 40049223  T
101 tcaattctgctccgcccaccggacttttggtttcactcactgccctttcaactccacttacttgtgttccacttattgctaaataccaaacacaaatata 200  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40049222 tcaattctgctccgctcaccggacttttggtttcactcactgccctttcaactccacttacttgtgttccacttattgctaaataccaaacacaaatata 40049123  T
201 tgcaaaacaagtgacgaataatatcacaagccaatttttgtccnnnnnnngtttatcttacaggtcagttatacattttctataacctctatactgttga 300  Q
    |||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||    
40049122 tgcaaaacaagtgacgaataatatcacaagccaatttttgtccaaaaaaagtttatcttacaggtcagttatacattttctataacctctatactgttga 40049023  T
301 ttccaactacatttattgcaatatgatttgagaaacaataatattaat 348  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
40049022 ttccaactacatttattgcaatatgatttgagaaacaataatattaat 40048975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 341 - 638
Target Start/End: Complemental strand, 40049865 - 40049568
Alignment:
341 atattaattctaaaatgaaaagtattgcttgtcttgttaaggacttatgacagggatcactttgctccttaagtgtttttgagtatcattgtcaggtctt 440  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40049865 atattaattctaaaatgaaaagtattgcttgtcttgttaaggacttatgacagggatcactttgctccttaagtgtttttgagtatcattgtcaggtctt 40049766  T
441 gttgaagacttatcaaatggtccccattttcttgctctagaagttgtatttttctttgaactcaaacaaagcaaagatacctcattttcacctcacattg 540  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40049765 gttgaagacttatcaaatggtccccattttcttgctctagaagttgtatttttctttgaactcaaacaaagcaaagatacctcattttcacctcacattg 40049666  T
541 tttataaatctttacattggggttgggaagcccaaaaccaatt-ccnatgcactttcaccgtgattgggctgaagctggaaaacatagcttctatccaa 638  Q
    |||||||||||||||||| | ||| |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||||||||||||||||||||    
40049665 tttataaatctttacatt-gtgtttggaagcccaaaaccaattcccaatgcactttcaccgtgatttggctgaagctggaaaacatagcttctatccaa 40049568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 8e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 566 - 638
Target Start/End: Original strand, 40821945 - 40822017
Alignment:
566 ggaagcccaaaaccaattccnatgcactttcaccgtgattgggctgaagctggaaaacatagcttctatccaa 638  Q
    |||||||||||||||||||  ||||| ||||||||||||| ||||||||||||||||||| | ||||| ||||    
40821945 ggaagcccaaaaccaattctcatgcaatttcaccgtgatttggctgaagctggaaaacatggtttctacccaa 40822017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 566 - 633
Target Start/End: Complemental strand, 6849778 - 6849710
Alignment:
566 ggaagcccaaaaccaattccnat-gcactttcaccgtgattgggctgaagctggaaaacatagcttcta 633  Q
    |||||||||||||||||| | || ||||||| ||||||||| ||||||||||||||||||| |||||||    
6849778 ggaagcccaaaaccaatttccattgcactttgaccgtgatttggctgaagctggaaaacattgcttcta 6849710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 566 - 625
Target Start/End: Complemental strand, 2428620 - 2428560
Alignment:
566 ggaagcccaaaaccaattc-cnatgcactttcaccgtgattgggctgaagctggaaaacat 625  Q
    ||||| ||||||||||||  | ||||||||||||||||||  ||| |||||||||||||||    
2428620 ggaagtccaaaaccaatttacaatgcactttcaccgtgatgtggcagaagctggaaaacat 2428560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 566 - 638
Target Start/End: Original strand, 34328758 - 34328831
Alignment:
566 ggaagcccaaaaccaattccna-tgcactttcaccgtgattgggctgaagctggaaaacatagcttctatccaa 638  Q
    |||||||||||||||||||| | ||||||||||||  |||| ||||||||||| |||| ||| |||||| ||||    
34328758 ggaagcccaaaaccaattcccaatgcactttcaccaagattcggctgaagctgcaaaatataacttctaaccaa 34328831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 593 - 633
Target Start/End: Complemental strand, 29420037 - 29419997
Alignment:
593 tttcaccgtgattgggctgaagctggaaaacatagcttcta 633  Q
    ||||||||||||| | |||||||||||||||||||||||||    
29420037 tttcaccgtgatttgactgaagctggaaaacatagcttcta 29419997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106068 times since January 2019
Visitors: 1319