View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_87 (Length: 629)

Name: J5_14_87
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_87
J5_14_87
[»] chr4 (1 HSPs)
chr4 (1-560)||(22360874-22361433)
[»] chr3 (1 HSPs)
chr3 (329-366)||(32148850-32148887)
[»] chr7 (1 HSPs)
chr7 (167-195)||(32522553-32522581)


Alignment Details
Target: chr4 (Bit Score: 506; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 506; E-Value: 0
Query Start/End: Original strand, 1 - 560
Target Start/End: Original strand, 22360874 - 22361433
Alignment:
1 ggatgaataatattgagaattgtaatctgtcgattaactcagatgaacgtgtttggttcatccagatgaaactctaaaattactacaacataaaaaccac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22360874 ggatgaataatattgagaattgtaatctgtcgattaactcagatgaacgtgtttggttcatccagatgaaactctaaaattactacaacataaaaaccac 22360973  T
101 attctttatatttagtcaatataattcaaatgaagtgattgagttagacacttcctcaattgaatctttttatgatattagagaaagtttgattcgaccc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22360974 attctttatatttagtcaatataattcaaatgaagtgattgagttagacacttcctcaattgaatctttttatgatattagagaaagtttgattcgaccc 22361073  T
201 ataacttaattggatcttttactggacaagctagccaccccgccatgttgaaggggactggactaccgacgagatatggaaaagagacagcataaggacc 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22361074 ataacttaattggatcttttactggacaagctagccaccccgccatgttgaaggggactggactaccgacgagatatggaaaagagacagcataaggacc 22361173  T
301 ccttttaacatccgcagaggttagaagttcaataaacacagttgtgttggtcccttcttgaaaaaatcttatgtcccttgttgagtttggcaggcatcaa 400  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
22361174 ccttttaacatccgcagaggttagaagttcaataaacacagttgtgttggtcccttcttgaaaaaatcttatgt-ccttgttgagtttggcaggcatcaa 22361272  T
401 gtgtgacacgaacgattctaacagtaccacttaatggatggagtaattnaattgaanttagacctttttggaaacattggtttttcntaaatttggatcc 500  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||| |||||||||||||    
22361273 gtgtgacacaaacgattctaacagtaccacttaatggatggagtaattaaattgaagttagacatttttggaaacattggtttttcgtaaatttggatcc 22361372  T
501 caattttactaacaattaanatgttnaaganccctccc-aaacnacgacntcngtattaat 560  Q
    ||||||||||||||||||| ||||| ||||  |||||| |||| ||||| || ||||||||    
22361373 caattttactaacaattaaaatgtttaagacacctcccaaaacaacgacatcagtattaat 22361433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 366
Target Start/End: Complemental strand, 32148887 - 32148850
Alignment:
329 tcaataaacacagttgtgttggtcccttcttgaaaaaa 366  Q
    |||||||||| || ||||||||||||||||||||||||    
32148887 tcaataaacatagctgtgttggtcccttcttgaaaaaa 32148850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 167 - 195
Target Start/End: Original strand, 32522553 - 32522581
Alignment:
167 tttttatgatattagagaaagtttgattc 195  Q
    |||||||||||||||||||||||||||||    
32522553 tttttatgatattagagaaagtttgattc 32522581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201872 times since January 2019
Visitors: 1513