View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_88 (Length: 406)

Name: J5_14_88
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_88
J5_14_88
[»] chr4 (6 HSPs)
chr4 (1-215)||(35774415-35774629)
chr4 (290-406)||(35774303-35774419)
chr4 (260-296)||(35774674-35774710)
chr4 (57-110)||(21688101-21688154)
chr4 (57-110)||(24274900-24274953)
chr4 (57-105)||(28145291-28145339)
[»] chr2 (3 HSPs)
chr2 (136-194)||(4421783-4421841)
chr2 (57-114)||(33227965-33228022)
chr2 (66-110)||(32454800-32454844)
[»] chr8 (3 HSPs)
chr8 (42-110)||(40038390-40038458)
chr8 (42-103)||(27490344-27490405)
chr8 (136-183)||(27490247-27490294)
[»] chr1 (2 HSPs)
chr1 (54-110)||(26173682-26173738)
chr1 (42-110)||(35388693-35388761)
[»] chr7 (1 HSPs)
chr7 (44-107)||(8063093-8063156)
[»] chr5 (2 HSPs)
chr5 (43-98)||(35147876-35147931)
chr5 (44-110)||(31653219-31653286)
[»] chr6 (1 HSPs)
chr6 (61-110)||(2805340-2805389)
[»] chr3 (1 HSPs)
chr3 (54-114)||(24110075-24110135)


Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 35774415 - 35774629
Alignment:
1 aattttgtaagaatttaacttttattttaaagagaccgatatccctctttaatcatatgttggaaagaaatgttagcaatatgctcatttaaatcaaaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35774415 aattttgtaagaatttaacttttattttaaagagaccgatatccctctttaatcatatgttggaaagaaatgttagcaatatgctcatttaaatcaaaga 35774514  T
101 tcttcaccaataaatttttggccaagctcggccaagtgtgacattttggcagactcctccttcgaagttggagtctgtgttgagacttgatgtctcaggc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35774515 tcttcaccaataaatttttggccaagctcggccaagtgtgacattttggcagactcctccttcgaagttggagtctgtgttgagacttgatgtctcaggc 35774614  T
201 tggatctatttgtgg 215  Q
    |||||||||||||||    
35774615 tggatctatttgtgg 35774629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 290 - 406
Target Start/End: Original strand, 35774303 - 35774419
Alignment:
290 attaattgttatattagtttttctgccaagtccggtttgaagacaggacctccgactctttatcctatatatgnnnnnnncntcttcttgttatacataa 389  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       | ||||||||||||||||||    
35774303 attaattgttatattagtttttctgccaagtccggtttgaagacaggacctccgactctttatcctatatatgtttttttcttcttcttgttatacataa 35774402  T
390 tttttgtattttaattt 406  Q
    |||||||||||||||||    
35774403 tttttgtattttaattt 35774419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 260 - 296
Target Start/End: Original strand, 35774674 - 35774710
Alignment:
260 gagaaggatatggaaaaaggttttcaaatcattaatt 296  Q
    |||||||||||||||||||||||||||||||||||||    
35774674 gagaaggatatggaaaaaggttttcaaatcattaatt 35774710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 110
Target Start/End: Original strand, 21688101 - 21688154
Alignment:
57 atgttggaaagaaatgttagcaatatgctcatttaaatcaaagatcttcaccaa 110  Q
    |||||||||| |||||||||  |||||||| |||||| |||| |||||||||||    
21688101 atgttggaaataaatgttagggatatgctcctttaaaccaaaaatcttcaccaa 21688154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 110
Target Start/End: Original strand, 24274900 - 24274953
Alignment:
57 atgttggaaagaaatgttagcaatatgctcatttaaatcaaagatcttcaccaa 110  Q
    |||||||||||||||||||  ||||||||| |||||  |||| |||||||||||    
24274900 atgttggaaagaaatgttacgaatatgctcctttaacccaaaaatcttcaccaa 24274953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 57 - 105
Target Start/End: Original strand, 28145291 - 28145339
Alignment:
57 atgttggaaagaaatgttagcaatatgctcatttaaatcaaagatcttc 105  Q
    |||||||||||||||||||| ||||||||| |||||  |||| ||||||    
28145291 atgttggaaagaaatgttaggaatatgctcctttaatccaaaaatcttc 28145339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 136 - 194
Target Start/End: Original strand, 4421783 - 4421841
Alignment:
136 gtgtgacattttggcagactcctccttcgaagttggagtctgtgttgagacttgatgtc 194  Q
    ||||||| ||||||||||||||||| |||||||||||| | |||||||| |||||||||    
4421783 gtgtgaccttttggcagactcctccatcgaagttggaggcagtgttgaggcttgatgtc 4421841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 114
Target Start/End: Original strand, 33227965 - 33228022
Alignment:
57 atgttggaaagaaatgttagcaatatgctcatttaaatcaaagatcttcaccaataaa 114  Q
    ||||||||||  ||| |||| ||||||||||||||||||||| ||||| || ||||||    
33227965 atgttggaaaataatattagaaatatgctcatttaaatcaaaaatctttacaaataaa 33228022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 66 - 110
Target Start/End: Original strand, 32454800 - 32454844
Alignment:
66 agaaatgttagcaatatgctcatttaaatcaaagatcttcaccaa 110  Q
    ||||||||||| ||||||||| |||||| ||||||| ||||||||    
32454800 agaaatgttaggaatatgctcctttaaaccaaagattttcaccaa 32454844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000009; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 40038390 - 40038458
Alignment:
42 tccctctttaatcatatgttggaaagaaatgttagcaatatgctcatttaaatcaaagatcttcaccaa 110  Q
    ||||||| ||| || |||||||||||||||||||  ||||| ||| |||||| ||||||||||||||||    
40038390 tccctctctaagcacatgttggaaagaaatgttaagaatattctcctttaaaccaaagatcttcaccaa 40038458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 42 - 103
Target Start/End: Original strand, 27490344 - 27490405
Alignment:
42 tccctctttaatcatatgttggaaagaaatgttagcaatatgctcatttaaatcaaagatct 103  Q
    ||||||| ||| || ||||| |||||||||||||| ||||||||| |||||| |||||||||    
27490344 tccctctctaagcacatgttagaaagaaatgttaggaatatgctcttttaaaccaaagatct 27490405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 136 - 183
Target Start/End: Complemental strand, 27490294 - 27490247
Alignment:
136 gtgtgacattttggcagactcctccttcgaagttggagtctgtgttga 183  Q
    ||||||||| ||||||||||||||||||  |||||||||| |||||||    
27490294 gtgtgacatattggcagactcctccttcagagttggagtcggtgttga 27490247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 54 - 110
Target Start/End: Complemental strand, 26173738 - 26173682
Alignment:
54 catatgttggaaagaaatgttagcaatatgctcatttaaatcaaagatcttcaccaa 110  Q
    ||||||||||||||||||||||| |||||||||||||||  |||| ||||| |||||    
26173738 catatgttggaaagaaatgttaggaatatgctcatttaacccaaaaatctttaccaa 26173682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 35388693 - 35388761
Alignment:
42 tccctctttaatcatatgttggaaagaaatgttagcaatatgctcatttaaatcaaagatcttcaccaa 110  Q
    ||||||| ||| || |||||||||||||||||||| ||||| | | ||||||  ||||||||| |||||    
35388693 tccctctctaaacacatgttggaaagaaatgttaggaatatacacttttaaactaaagatctttaccaa 35388761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 44 - 107
Target Start/End: Complemental strand, 8063156 - 8063093
Alignment:
44 cctctttaatcatatgttggaaagaaatgttagcaatatgctcatttaaatcaaagatcttcac 107  Q
    ||||| ||| || |||||||||||||||||||| ||||||||| |||||| |||| ||||||||    
8063156 cctctctaagcacatgttggaaagaaatgttaggaatatgctcctttaaaccaaaaatcttcac 8063093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 43 - 98
Target Start/End: Original strand, 35147876 - 35147931
Alignment:
43 ccctctttaatcatatgttggaaagaaatgttagcaatatgctcatttaaatcaaa 98  Q
    |||||||||| || |||||||||| ||||||||| |||||||||||||||| ||||    
35147876 ccctctttaagcacatgttggaaataaatgttaggaatatgctcatttaaaccaaa 35147931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 44 - 110
Target Start/End: Original strand, 31653219 - 31653286
Alignment:
44 cctctttaatcatatgttggaaagaaatgttagca-atatgctcatttaaatcaaagatcttcaccaa 110  Q
    ||||| ||| || |||||||||||||||||||| | |||||||||||||||  ||| |||||||||||    
31653219 cctctctaagcacatgttggaaagaaatgttaggatatatgctcatttaaactaaaaatcttcaccaa 31653286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 61 - 110
Target Start/End: Complemental strand, 2805389 - 2805340
Alignment:
61 tggaaagaaatgttagcaatatgctcatttaaatcaaagatcttcaccaa 110  Q
    |||||||||||||||||||||| ||| |||||| |||| |||||||||||    
2805389 tggaaagaaatgttagcaatatactcctttaaaccaaaaatcttcaccaa 2805340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 54 - 114
Target Start/End: Original strand, 24110075 - 24110135
Alignment:
54 catatgttggaaagaaatgttagcaatatgctcatttaaatcaaagatcttcaccaataaa 114  Q
    ||||||||||||||||||||||| |||||| || |||||  |||| ||||||| |||||||    
24110075 catatgttggaaagaaatgttagaaatatgttcctttaatccaaaaatcttcatcaataaa 24110135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 304580 times since January 2019
Visitors: 437