View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_89 (Length: 519)

Name: J5_14_89
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_89
J5_14_89
[»] chr2 (4 HSPs)
chr2 (245-442)||(37560486-37560683)
chr2 (68-186)||(37560309-37560427)
chr2 (1-73)||(37560755-37560827)
chr2 (480-509)||(37560721-37560750)


Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 245 - 442
Target Start/End: Original strand, 37560486 - 37560683
Alignment:
245 tactcacatgtaaatggaggaattcaaattcaaactccgatcaataattttgacgtttttatccgttaaactatgtatgtggacccaaaactagttcatt 344  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37560486 tactcacatgtaaatggaggaattcaaattcaaactccgatcaataattttgacgtttttatccgttaaactatgtatgtggacccaaaactagttcatt 37560585  T
345 caaccggaccaaaattgacgccactatacatggaaaaaagataataacttgtgtccaaaagataatatctttttgaccccnaaagaataagaaaaagg 442  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
37560586 caaccggaccaaaattgacgccactatacatggaaaaaagataataacttgtgtccaaaagataatatctttttgaccccaaaagaataagaaaaagg 37560683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 68 - 186
Target Start/End: Original strand, 37560309 - 37560427
Alignment:
68 attaatcaaaataaattgcttgaatatcaagattgagtgaactctcctagaaaaaagattgagtgagctcaatccaccagaggtataaggagcatgtttt 167  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37560309 attaatcaaaataaattgtttgaatatcaagattgagtgaactctcctagaaaaaagattgagtgagctcaatccaccagaggtataaggagcatgtttt 37560408  T
168 taaagagttgaatcgaatc 186  Q
    |||||||||||||||||||    
37560409 taaagagttgaatcgaatc 37560427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 37560755 - 37560827
Alignment:
1 ataacatcattctctccacgtctgtgtttccaacaatattcaacttcttcaacaacaaaattcatctattaat 73  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37560755 ataacatcattctctccacgtctgtgtttccaacaatattcaacttcttcaacaacaaaattcatctattaat 37560827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 480 - 509
Target Start/End: Original strand, 37560721 - 37560750
Alignment:
480 gaggaaaagacatgatactatgttgatcgc 509  Q
    ||||||||||||||||||||||||||||||    
37560721 gaggaaaagacatgatactatgttgatcgc 37560750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111007 times since January 2019
Visitors: 1335