View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_14_92 (Length: 707)

Name: J5_14_92
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_14_92
J5_14_92
[»] chr8 (4 HSPs)
chr8 (1-707)||(26553346-26554051)
chr8 (73-243)||(26776869-26777039)
chr8 (426-533)||(26777213-26777320)
chr8 (353-386)||(26777170-26777203)


Alignment Details
Target: chr8 (Bit Score: 626; Significance: 0; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 626; E-Value: 0
Query Start/End: Original strand, 1 - 707
Target Start/End: Complemental strand, 26554051 - 26553346
Alignment:
1 gttgaacaggctatttcttcaaggcctggagaaccatggatggggtgactggcgaagtatatcaaggtacagtgtggtgacaagaacacctacacaagta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26554051 gttgaacaggctatttcttcaaggcctggagaaccatggatggggtgactggcgaagtatatcaaggtacagtgtggtgacaagaacacctacacaagta 26553952  T
101 gcaagccatgctcagaaatacaaaattcgtcaggattcaatgaaagagaagaaagaaagaaggcgatccagcatacatgatgtcacctttgtcaaaaatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26553951 gcaagccatgctcagaaatacaaaattcgtcaggattcaatgaaagagaagaaagaaagaaggcgatccagcatacatgatgtcacctttgtcaaaaatg 26553852  T
201 gagacatttcagcacctcaaggaccaattaccggtcaagcaagcaattctgctgcaaattctgctggacaatcagccgaacaagctcctccagtcccacc 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26553851 gagacatttcagcacctcaaggaccaattaccggtcaagcaagcaattctgctgcaaattctgctggacaatcagccgaacaagctcctccagtcccacc 26553752  T
301 tgctggaatcaaaactcttgataatcctccatccccacctgctggaatacacgctgctcctaggatcgggcaacctataggaggaccagttgtatctgca 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26553751 tgctggaatcaaaactcttgataatcctccatccccacctgctggaatacacgctgctcctaggatcgggcaacctataggaggaccagttgtatctgca 26553652  T
401 gttggtactacagtgaatttgactgctcccggagacatggattatggtcttggaccngtttctgagacagttatgccaggggtaccnatgaacctgggtc 500  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||    
26553651 gttggtactacagtgaatttgactgctcccggagacatggattatggtcttggaccagtttctgagacagttatgccaggggtaccaatgaacctgggtc 26553552  T
501 ctatgacatatgccatgctacatacatatgctccatcatgaagtggttataagaggcgcngtgtacatgcatagaaagaacatttagntttttaattctt 600  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||    
26553551 ctatgacatatgccatgctacatacatatgctcaatcatgaagtggttataagaggcgcagtgtacatgcatagaaagaacatttag-tttttaattctt 26553453  T
601 tttatattcgtacnttggtgcttgtatccaagctagagnnnnnnngctcctncaattattttgaanaananatgaatatttgacatccttnacntaggac 700  Q
    ||||||||||||| ||| ||||||||||||||||||||       |||| | ||||||||||||| || | |||||||||||||||||||  | ||||||    
26553452 tttatattcgtacattgttgcttgtatccaagctagagtttttttgctcattcaattattttgaataagacatgaatatttgacatccttagcataggac 26553353  T
701 ngcnttt 707  Q
     || |||    
26553352 tgcattt 26553346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 73 - 243
Target Start/End: Original strand, 26776869 - 26777039
Alignment:
73 tgtggtgacaagaacacctacacaagtagcaagccatgctcagaaatacaaaattcgtcaggattcaatgaaagagaagaaagaaagaaggcgatccagc 172  Q
    ||||||||||| ||||| ||||||| ||||||| |||||||| ||||||   |   ||| | |||||| |||||||||||||||||||||||||||||||    
26776869 tgtggtgacaaaaacacatacacaaatagcaagtcatgctcaaaaatacttcaaaggtctgaattcaacgaaagagaagaaagaaagaaggcgatccagc 26776968  T
173 atacatgatgtcacctttgtcaaaaatggagacatttcagcacctcaaggaccaattaccggtcaagcaag 243  Q
    | |||||||||||| | |||| ||||||||||||||||||||||||| ||| |||||||||||||||||||    
26776969 agacatgatgtcacatatgtcgaaaatggagacatttcagcacctcatggagcaattaccggtcaagcaag 26777039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 426 - 533
Target Start/End: Original strand, 26777213 - 26777320
Alignment:
426 ctcccggagacatggattatggtcttggaccngtttctgagacagttatgccaggggtaccnatgaacctgggtcctatgacatatgccatgctacatac 525  Q
    |||||||| | |||| ||||||| ||||||| ||||||  ||||  ||||||||||||||| |||||| ||||||||||||||| | |||||| | ||||    
26777213 ctcccggacagatggcttatggtattggaccagtttcttggacaagtatgccaggggtaccaatgaacttgggtcctatgacatttcccatgcaaaatac 26777312  T
526 atatgctc 533  Q
    ||||||||    
26777313 atatgctc 26777320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 353 - 386
Target Start/End: Original strand, 26777170 - 26777203
Alignment:
353 gctgctcctaggatcgggcaacctataggaggac 386  Q
    ||||||| ||||||||||||||||||||||||||    
26777170 gctgctcataggatcgggcaacctataggaggac 26777203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108278 times since January 2019
Visitors: 1329