View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_15_46 (Length: 283)

Name: J5_15_46
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_15_46
J5_15_46
[»] chr4 (3 HSPs)
chr4 (172-283)||(2648444-2648555)
chr4 (1-78)||(2648551-2648628)
chr4 (127-172)||(42655492-42655537)
[»] chr3 (1 HSPs)
chr3 (72-175)||(45479722-45479825)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 7e-55; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 172 - 283
Target Start/End: Original strand, 2648444 - 2648555
Alignment:
172 aattgtcacagtgtaatgaatattcgtaccattaaaatnatataactgaccctactagatatcacaataacattcacaaagagatccatgtcgttttcat 271  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2648444 aattgtcacagtgtaatgaatattcgtaccattaaaatcatataactgaccctactagatatcacaataacattcacaaagagatccatgtcgttttcat 2648543  T
272 gtcaattattct 283  Q
    ||||||||||||    
2648544 gtcaattattct 2648555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 2648551 - 2648628
Alignment:
1 attcntngggaatccacagaatttttacagtcaattttgttnggaaaaattgtttttgctttacgtgcaatttgaatt 78  Q
    |||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
2648551 attctttgggaatccacagaatttttacagtcaattttgtttggaaaaattgtttttgctttacgtgcaatttgaatt 2648628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 172
Target Start/End: Complemental strand, 42655537 - 42655492
Alignment:
127 tgattccagctcacatcatagctgaagcgatatcaactatccgcga 172  Q
    ||||||| ||||| |||||||||||||| |||||||||||||||||    
42655537 tgattcctgctcatatcatagctgaagcaatatcaactatccgcga 42655492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 72 - 175
Target Start/End: Complemental strand, 45479825 - 45479722
Alignment:
72 ttgaattgaagctgaaaaatggtgtgaattgtatcaaaacagaanggacatgcaatgattccagctcacatcatagctgaagcgatatcaactatccgcg 171  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45479825 ttgaattgaagctgaaaaatggtgtgaattgtatcaaaacagaaaggacatgcaatgattccagctcacatcatagctgaagcgatatcaactatccgcg 45479726  T
172 aatt 175  Q
    ||||    
45479725 aatt 45479722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 362105 times since January 2019
Visitors: 488