View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_15_51 (Length: 299)

Name: J5_15_51
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_15_51
J5_15_51
[»] chr7 (4 HSPs)
chr7 (1-237)||(40438741-40438977)
chr7 (16-233)||(40428241-40428448)
chr7 (232-299)||(40438973-40439040)
chr7 (235-286)||(47559714-47559762)
[»] chr2 (3 HSPs)
chr2 (254-290)||(9404512-9404548)
chr2 (254-290)||(34339035-34339071)
chr2 (254-290)||(9878061-9878097)
[»] chr4 (1 HSPs)
chr4 (235-288)||(39063748-39063802)
[»] chr5 (3 HSPs)
chr5 (254-295)||(6738529-6738570)
chr5 (254-290)||(10391265-10391301)
chr5 (254-290)||(27104536-27104572)
[»] chr3 (2 HSPs)
chr3 (235-290)||(20173994-20174046)
chr3 (254-299)||(29094284-29094329)
[»] chr8 (1 HSPs)
chr8 (254-290)||(26716558-26716594)


Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 40438977 - 40438741
Alignment:
1 cgtttttatccaaacagtcaggttatgattttgatattgattattagttgttctttgtagacactgttatatatattgttgngaatggtggcagagattg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
40438977 cgtttttatccaaacagtcaggttatgattttgatattgattattagttgttctttgtagacactgttatatatattgttgtgaatggtggcagagattg 40438878  T
101 tgcagttgctgctagaccatgatccagagctaatcaagacatttgcacagtcaaatgcaactcctcttgtatctgcagctacaagagggcatgcggatat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40438877 tgcagttgctgctagaccatgatccagagctaatcaagacatttgcacagtcaaatgcaactcctcttgtatctgcagctacaagagggcatgcggatat 40438778  T
201 tgttgaattgttactatcttatgatcctagtcaattg 237  Q
    |||||||||||||||||||||||||||||||||||||    
40438777 tgttgaattgttactatcttatgatcctagtcaattg 40438741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 40428448 - 40428241
Alignment:
16 agtcaggttatgattttgatattgattattagttgttctttgtagacactgttat-atatattgttgngaatggtggcagagattgtgcagttgctgcta 114  Q
    |||||||||||||||||||||||||| |||       |||||||||||||||||| | ||||||||  |||| ||||||||  ||||||| |||||||||    
40428448 agtcaggttatgattttgatattgataatt-------ctttgtagacactgttattaaatattgtt-tgaattgtggcagatgttgtgcaattgctgcta 40428357  T
115 gaccatgatccagagctaatcaagacatttgcacagtcaaatgcaactcctcttgtatctgcagctacaagagggcatgcggatattgttgaattgttac 214  Q
    |||||||||||||||||||||||||| ||| |||| ||||||||||| ||||||||||||||  ||||||||||||||||  || ||||||||   ||||    
40428356 gaccatgatccagagctaatcaagacttttccacactcaaatgcaacccctcttgtatctgctcctacaagagggcatgcatatgttgttgaa---ttac 40428260  T
215 tatcttatgatcctagtca 233  Q
    ||||||  |||||||||||    
40428259 tatcttgcgatcctagtca 40428241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 232 - 299
Target Start/End: Complemental strand, 40439040 - 40438973
Alignment:
232 caattgttatagaaataacttgttatacataagcacttatatgattagtgtttatgctagaaacgttt 299  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40439040 caattgttatagaaataacttgttatacataagcacttatatgattagtgtttatgctagaaacgttt 40438973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 286
Target Start/End: Original strand, 47559714 - 47559762
Alignment:
235 ttgttatagaaataacttgttatacataagcacttatatgattagtgtttat 286  Q
    ||||| |||||||||||| ||   ||||||||||||||||||||||||||||    
47559714 ttgttgtagaaataacttatt---cataagcacttatatgattagtgtttat 47559762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 254 - 290
Target Start/End: Complemental strand, 9404548 - 9404512
Alignment:
254 ttatacataagcacttatatgattagtgtttatgcta 290  Q
    ||||||||||||||||||||||| |||||||||||||    
9404548 ttatacataagcacttatatgataagtgtttatgcta 9404512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 254 - 290
Target Start/End: Complemental strand, 34339071 - 34339035
Alignment:
254 ttatacataagcacttatatgattagtgtttatgcta 290  Q
    ||||||||||||||||||||||| |||||||||||||    
34339071 ttatacataagcacttatatgataagtgtttatgcta 34339035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 254 - 290
Target Start/End: Original strand, 9878061 - 9878097
Alignment:
254 ttatacataagcacttatatgattagtgtttatgcta 290  Q
    |||||||||||||||||||||||||  ||||||||||    
9878061 ttatacataagcacttatatgattaacgtttatgcta 9878097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 288
Target Start/End: Original strand, 39063748 - 39063802
Alignment:
235 ttgttatagaaataactt-gttatacataagcacttatatgattagtgtttatgc 288  Q
    |||| ||||||||| ||| |||||||||||||||||||||||| |||| ||||||    
39063748 ttgtaatagaaatagcttagttatacataagcacttatatgataagtggttatgc 39063802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 295
Target Start/End: Original strand, 6738529 - 6738570
Alignment:
254 ttatacataagcacttatatgattagtgtttatgctagaaac 295  Q
    ||||||||||| ||||||||||| ||||||||||||| ||||    
6738529 ttatacataagtacttatatgataagtgtttatgctataaac 6738570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 254 - 290
Target Start/End: Complemental strand, 10391301 - 10391265
Alignment:
254 ttatacataagcacttatatgattagtgtttatgcta 290  Q
    |||||| |||||||||||||||| |||||||||||||    
10391301 ttatacgtaagcacttatatgataagtgtttatgcta 10391265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 254 - 290
Target Start/End: Original strand, 27104536 - 27104572
Alignment:
254 ttatacataagcacttatatgattagtgtttatgcta 290  Q
    |||||| |||||||||||||||| |||||||||||||    
27104536 ttatacgtaagcacttatatgataagtgtttatgcta 27104572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 290
Target Start/End: Original strand, 20173994 - 20174046
Alignment:
235 ttgttatagaaataacttgttatacataagcacttatatgattagtgtttatgcta 290  Q
    |||||||||||||||||    |||||||||||||||||| | ||||||||||||||    
20173994 ttgttatagaaataacta---atacataagcacttatataactagtgtttatgcta 20174046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 299
Target Start/End: Complemental strand, 29094329 - 29094284
Alignment:
254 ttatacataagcacttatatgattagtgtttatgctagaaacgttt 299  Q
    |||||||||| |||||||||||| ||||||||||||| || |||||    
29094329 ttatacataaacacttatatgataagtgtttatgctataagcgttt 29094284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 254 - 290
Target Start/End: Original strand, 26716558 - 26716594
Alignment:
254 ttatacataagcacttatatgattagtgtttatgcta 290  Q
    |||||||||||||||||||| || |||||||||||||    
26716558 ttatacataagcacttatataataagtgtttatgcta 26716594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105888 times since January 2019
Visitors: 1319