View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_15_61 (Length: 178)

Name: J5_15_61
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_15_61
J5_15_61
[»] chr5 (60 HSPs)
chr5 (3-178)||(5642697-5642872)
chr5 (3-178)||(18495801-18495976)
chr5 (3-178)||(24728878-24729053)
chr5 (3-178)||(34621427-34621602)
chr5 (3-178)||(43083164-43083339)
chr5 (3-178)||(11328546-11328721)
chr5 (3-178)||(13437759-13437934)
chr5 (3-178)||(22994193-22994368)
chr5 (3-178)||(31436373-31436548)
chr5 (3-178)||(37666562-37666737)
chr5 (3-178)||(40468626-40468801)
chr5 (3-178)||(2515971-2516146)
chr5 (3-178)||(3794450-3794625)
chr5 (3-178)||(13319906-13320081)
chr5 (3-178)||(15753928-15754103)
chr5 (3-178)||(28954861-28955036)
chr5 (3-178)||(30173378-30173553)
chr5 (3-178)||(30939544-30939719)
chr5 (3-178)||(31821483-31821658)
chr5 (3-178)||(37353719-37353894)
chr5 (3-178)||(37747405-37747580)
chr5 (3-178)||(8660551-8660726)
chr5 (3-178)||(9545785-9545960)
chr5 (3-178)||(11554264-11554439)
chr5 (3-178)||(13181869-13182044)
chr5 (3-178)||(15653833-15654008)
chr5 (3-178)||(24974756-24974931)
chr5 (3-178)||(30156940-30157115)
chr5 (3-178)||(32591350-32591525)
chr5 (3-178)||(33521289-33521464)
chr5 (3-178)||(33880037-33880212)
chr5 (3-178)||(37759892-37760067)
chr5 (3-178)||(41679614-41679789)
chr5 (3-178)||(18123492-18123667)
chr5 (3-178)||(28654152-28654327)
chr5 (3-178)||(33297437-33297612)
chr5 (3-178)||(33782394-33782569)
chr5 (3-178)||(18370610-18370785)
chr5 (3-178)||(23896784-23896959)
chr5 (3-178)||(30034337-30034512)
chr5 (3-178)||(6879214-6879389)
chr5 (3-178)||(9322385-9322560)
chr5 (3-178)||(12137084-12137259)
chr5 (3-178)||(23630878-23631053)
chr5 (3-178)||(26485303-26485478)
chr5 (3-178)||(25205187-25205362)
chr5 (3-178)||(25269342-25269517)
chr5 (3-178)||(29886273-29886448)
chr5 (86-178)||(24588283-24588375)
chr5 (103-178)||(22893372-22893447)
chr5 (45-178)||(20387131-20387264)
chr5 (115-178)||(350427-350490)
chr5 (99-178)||(24065362-24065441)
chr5 (99-178)||(34470507-34470586)
chr5 (33-166)||(3482333-3482466)
chr5 (117-178)||(12889172-12889233)
chr5 (120-178)||(36374179-36374237)
chr5 (120-178)||(36998833-36998891)
chr5 (117-178)||(5438439-5438500)
chr5 (3-43)||(22893455-22893495)
[»] scaffold0159 (3 HSPs)
scaffold0159 (3-178)||(4358-4533)
scaffold0159 (104-178)||(24475-24549)
scaffold0159 (3-59)||(13974-14031)
[»] scaffold0038 (1 HSPs)
scaffold0038 (3-178)||(12851-13026)
[»] chr8 (28 HSPs)
chr8 (3-178)||(12087863-12088038)
chr8 (3-178)||(15772475-15772650)
chr8 (3-178)||(14562525-14562700)
chr8 (3-178)||(16287853-16288028)
chr8 (3-178)||(19679348-19679523)
chr8 (3-178)||(29834226-29834401)
chr8 (3-178)||(31485011-31485186)
chr8 (3-178)||(33263635-33263810)
chr8 (3-178)||(44565885-44566060)
chr8 (3-178)||(2132400-2132575)
chr8 (3-178)||(19912302-19912477)
chr8 (3-178)||(21343311-21343486)
chr8 (3-178)||(27604045-27604220)
chr8 (3-178)||(28357092-28357267)
chr8 (3-178)||(9359526-9359701)
chr8 (3-178)||(22137811-22137986)
chr8 (3-178)||(33247271-33247446)
chr8 (3-178)||(31359429-31359604)
chr8 (3-178)||(19656480-19656656)
chr8 (3-178)||(19692999-19693175)
chr8 (3-178)||(18795605-18795780)
chr8 (3-178)||(18714385-18714560)
chr8 (3-178)||(19203502-19203677)
chr8 (3-178)||(22076065-22076240)
chr8 (45-178)||(16770200-16770333)
chr8 (33-166)||(22413827-22413960)
chr8 (33-166)||(14213928-14214061)
chr8 (72-166)||(19846052-19846146)
[»] chr7 (43 HSPs)
chr7 (3-178)||(31128806-31128981)
chr7 (3-178)||(2105227-2105402)
chr7 (3-178)||(3450205-3450380)
chr7 (3-178)||(4204288-4204463)
chr7 (3-178)||(31559454-31559629)
chr7 (3-178)||(39208203-39208378)
chr7 (3-178)||(45392119-45392294)
chr7 (3-178)||(11445786-11445961)
chr7 (3-178)||(24587598-24587773)
chr7 (3-178)||(45736206-45736381)
chr7 (3-175)||(26517694-26517866)
chr7 (3-178)||(5152983-5153158)
chr7 (3-178)||(5163282-5163457)
chr7 (3-178)||(11419843-11420018)
chr7 (3-178)||(26532937-26533112)
chr7 (3-178)||(4140310-4140485)
chr7 (3-178)||(5142404-5142579)
chr7 (3-178)||(16513494-16513669)
chr7 (3-178)||(26270150-26270325)
chr7 (3-178)||(26510760-26510935)
chr7 (3-178)||(26664978-26665153)
chr7 (3-178)||(26680170-26680345)
chr7 (3-178)||(2159473-2159648)
chr7 (3-178)||(31085686-31085861)
chr7 (3-178)||(10911933-10912108)
chr7 (3-178)||(16746581-16746756)
chr7 (3-178)||(26440156-26440331)
chr7 (3-178)||(2778153-2778328)
chr7 (3-178)||(26314912-26315087)
chr7 (3-178)||(10846519-10846694)
chr7 (3-178)||(16445070-16445245)
chr7 (5-174)||(16046218-16046387)
chr7 (45-178)||(1891705-1891838)
chr7 (99-178)||(796707-796786)
chr7 (33-166)||(16125936-16126069)
chr7 (33-166)||(29091403-29091536)
chr7 (33-166)||(2558422-2558555)
chr7 (33-166)||(15194970-15195103)
chr7 (33-166)||(16239303-16239436)
chr7 (99-178)||(16285563-16285642)
chr7 (120-178)||(9471191-9471249)
chr7 (120-178)||(16391639-16391697)
chr7 (117-178)||(30368148-30368209)
[»] chr6 (52 HSPs)
chr6 (3-178)||(4530184-4530359)
chr6 (3-178)||(4540896-4541071)
chr6 (3-178)||(4777779-4777954)
chr6 (3-178)||(8900825-8901000)
chr6 (3-178)||(27012630-27012805)
chr6 (3-178)||(28212353-28212528)
chr6 (3-177)||(4719257-4719431)
chr6 (3-178)||(27199084-27199259)
chr6 (3-178)||(27249975-27250150)
chr6 (3-178)||(28165390-28165565)
chr6 (3-178)||(13294073-13294248)
chr6 (3-178)||(16939149-16939324)
chr6 (3-178)||(24300879-24301054)
chr6 (3-178)||(26773749-26773924)
chr6 (3-178)||(27490032-27490207)
chr6 (3-178)||(4762662-4762837)
chr6 (3-178)||(13519316-13519491)
chr6 (3-178)||(15407655-15407830)
chr6 (3-178)||(15419442-15419617)
chr6 (3-178)||(16679039-16679214)
chr6 (3-178)||(26111534-26111709)
chr6 (3-178)||(26790715-26790890)
chr6 (3-178)||(27357232-27357407)
chr6 (3-178)||(29506315-29506490)
chr6 (3-178)||(30553138-30553313)
chr6 (11-178)||(33371561-33371728)
chr6 (3-178)||(34459628-34459803)
chr6 (3-178)||(14140516-14140691)
chr6 (3-178)||(22930006-22930181)
chr6 (3-178)||(23852451-23852626)
chr6 (3-178)||(24868615-24868790)
chr6 (3-178)||(27062405-27062580)
chr6 (3-178)||(27183828-27184003)
chr6 (3-178)||(27265236-27265411)
chr6 (3-178)||(27024036-27024211)
chr6 (3-178)||(29554456-29554632)
chr6 (3-147)||(26925700-26925844)
chr6 (3-178)||(16754720-16754895)
chr6 (3-178)||(29577913-29578088)
chr6 (3-178)||(27285486-27285661)
chr6 (3-178)||(27624833-27625008)
chr6 (3-178)||(17087565-17087740)
chr6 (3-166)||(20173458-20173621)
chr6 (3-166)||(22162370-22162533)
chr6 (30-178)||(27546777-27546925)
chr6 (75-174)||(25708833-25708932)
chr6 (33-160)||(21363814-21363941)
chr6 (33-160)||(23967796-23967923)
chr6 (33-166)||(18121356-18121489)
chr6 (33-166)||(18210845-18210978)
chr6 (140-178)||(26923276-26923314)
chr6 (117-178)||(9134613-9134674)
[»] chr4 (32 HSPs)
chr4 (3-178)||(30758675-30758850)
chr4 (3-178)||(17017961-17018136)
chr4 (3-178)||(54838306-54838481)
chr4 (3-178)||(5699450-5699625)
chr4 (3-178)||(6574773-6574948)
chr4 (3-178)||(18312357-18312532)
chr4 (3-178)||(27158496-27158671)
chr4 (3-178)||(39855552-39855727)
chr4 (3-178)||(14103458-14103633)
chr4 (3-178)||(14669928-14670103)
chr4 (3-178)||(18795793-18795968)
chr4 (3-178)||(21974616-21974791)
chr4 (3-178)||(24587540-24587715)
chr4 (3-178)||(31121691-31121866)
chr4 (3-178)||(34184139-34184314)
chr4 (3-178)||(40100816-40100991)
chr4 (3-178)||(14754671-14754846)
chr4 (3-178)||(20333600-20333775)
chr4 (3-178)||(24117577-24117752)
chr4 (3-178)||(33668979-33669154)
chr4 (3-178)||(1905169-1905344)
chr4 (3-178)||(5010790-5010965)
chr4 (3-178)||(15277806-15277981)
chr4 (3-178)||(36339696-36339871)
chr4 (3-178)||(15232731-15232906)
chr4 (3-178)||(15381422-15381597)
chr4 (30-178)||(1880329-1880477)
chr4 (115-178)||(22144884-22144947)
chr4 (33-166)||(14724032-14724165)
chr4 (33-166)||(19769242-19769375)
chr4 (99-178)||(55786023-55786102)
chr4 (115-166)||(12517126-12517177)
[»] chr3 (65 HSPs)
chr3 (3-178)||(51786886-51787061)
chr3 (3-178)||(5715936-5716111)
chr3 (3-178)||(5726846-5727021)
chr3 (3-178)||(5765347-5765522)
chr3 (3-178)||(6537964-6538139)
chr3 (3-178)||(8284692-8284867)
chr3 (3-178)||(18247604-18247779)
chr3 (3-178)||(20572065-20572240)
chr3 (3-178)||(22866070-22866245)
chr3 (3-178)||(22881129-22881304)
chr3 (3-178)||(28344040-28344215)
chr3 (3-178)||(31031458-31031633)
chr3 (3-178)||(31959677-31959852)
chr3 (3-178)||(32444014-32444189)
chr3 (3-178)||(4688518-4688693)
chr3 (3-178)||(4726493-4726668)
chr3 (3-178)||(7078069-7078244)
chr3 (3-178)||(15887927-15888102)
chr3 (3-178)||(20070903-20071078)
chr3 (3-178)||(28026144-28026319)
chr3 (3-178)||(4341898-4342073)
chr3 (3-178)||(4421778-4421953)
chr3 (3-178)||(4628648-4628823)
chr3 (3-178)||(10401007-10401182)
chr3 (3-178)||(15736316-15736491)
chr3 (3-178)||(18335493-18335668)
chr3 (3-178)||(22382800-22382975)
chr3 (3-178)||(24333026-24333201)
chr3 (3-178)||(29143978-29144153)
chr3 (3-178)||(47028316-47028491)
chr3 (3-178)||(5018577-5018752)
chr3 (3-178)||(5591579-5591754)
chr3 (3-178)||(5656997-5657172)
chr3 (3-178)||(11105581-11105756)
chr3 (3-178)||(17980171-17980346)
chr3 (3-178)||(18230059-18230234)
chr3 (3-178)||(18287575-18287750)
chr3 (3-178)||(18302876-18303051)
chr3 (3-178)||(21679566-21679741)
chr3 (3-178)||(29660192-29660367)
chr3 (3-178)||(48470790-48470965)
chr3 (3-178)||(5604536-5604711)
chr3 (3-178)||(6206767-6206942)
chr3 (3-178)||(5471851-5472026)
chr3 (3-178)||(8001423-8001598)
chr3 (3-178)||(8216497-8216672)
chr3 (3-178)||(10647936-10648111)
chr3 (3-178)||(35885629-35885804)
chr3 (3-178)||(4791857-4792032)
chr3 (3-178)||(17972083-17972258)
chr3 (3-178)||(18056125-18056300)
chr3 (3-178)||(32295491-32295666)
chr3 (3-178)||(28111176-28111351)
chr3 (3-178)||(16619712-16619887)
chr3 (3-178)||(19699353-19699527)
chr3 (3-72)||(16421154-16421223)
chr3 (45-178)||(4451614-4451747)
chr3 (70-166)||(6573205-6573301)
chr3 (63-178)||(6961739-6961854)
chr3 (99-178)||(20444956-20445035)
chr3 (70-166)||(7087357-7087453)
chr3 (33-166)||(22961304-22961437)
chr3 (33-166)||(11923634-11923767)
chr3 (33-166)||(16433256-16433389)
chr3 (69-178)||(15920356-15920465)
[»] chr2 (46 HSPs)
chr2 (3-178)||(9345154-9345329)
chr2 (3-178)||(22923316-22923491)
chr2 (3-178)||(12591709-12591884)
chr2 (3-178)||(19411669-19411844)
chr2 (3-178)||(21672343-21672518)
chr2 (3-178)||(27429609-27429784)
chr2 (3-178)||(27781135-27781310)
chr2 (3-178)||(27808604-27808779)
chr2 (3-178)||(27820892-27821067)
chr2 (3-178)||(12660438-12660613)
chr2 (3-178)||(27121425-27121600)
chr2 (3-178)||(28887180-28887355)
chr2 (3-178)||(31888659-31888834)
chr2 (3-178)||(39894970-39895145)
chr2 (3-178)||(11630352-11630527)
chr2 (3-178)||(12711769-12711944)
chr2 (3-178)||(16166381-16166556)
chr2 (3-178)||(16824506-16824681)
chr2 (3-178)||(16896799-16896974)
chr2 (3-178)||(20842814-20842989)
chr2 (3-178)||(23123737-23123912)
chr2 (3-178)||(32054704-32054879)
chr2 (3-178)||(37681063-37681238)
chr2 (3-178)||(37696328-37696503)
chr2 (3-178)||(37930270-37930445)
chr2 (3-178)||(37947030-37947205)
chr2 (3-178)||(40238409-40238584)
chr2 (3-178)||(34270088-34270263)
chr2 (3-178)||(34296055-34296230)
chr2 (3-178)||(34866585-34866760)
chr2 (3-178)||(39046987-39047162)
chr2 (6-178)||(31881187-31881359)
chr2 (3-178)||(255821-255996)
chr2 (3-178)||(34159745-34159920)
chr2 (3-178)||(13931715-13931890)
chr2 (3-178)||(37382578-37382753)
chr2 (3-178)||(3787394-3787569)
chr2 (3-178)||(19451591-19451766)
chr2 (3-178)||(21698338-21698513)
chr2 (45-178)||(26722510-26722643)
chr2 (30-178)||(34532662-34532810)
chr2 (33-166)||(34702965-34703098)
chr2 (99-178)||(21758903-21758982)
chr2 (33-166)||(42395424-42395557)
chr2 (117-178)||(12385537-12385598)
chr2 (117-178)||(22951270-22951331)
[»] chr1 (12 HSPs)
chr1 (3-178)||(51643122-51643297)
chr1 (3-178)||(3646047-3646222)
chr1 (3-178)||(10949981-10950156)
chr1 (3-178)||(28154640-28154815)
chr1 (3-178)||(41788489-41788664)
chr1 (3-178)||(10967569-10967744)
chr1 (3-178)||(28589984-28590159)
chr1 (3-178)||(21892926-21893101)
chr1 (3-178)||(20465880-20466055)
chr1 (3-178)||(20335595-20335770)
chr1 (19-178)||(16203229-16203388)
chr1 (33-166)||(22490913-22491046)
[»] scaffold0418 (1 HSPs)
scaffold0418 (3-178)||(10938-11113)
[»] scaffold0240 (1 HSPs)
scaffold0240 (3-178)||(26078-26253)
[»] scaffold0144 (1 HSPs)
scaffold0144 (3-178)||(21370-21545)
[»] scaffold0415 (1 HSPs)
scaffold0415 (3-178)||(10926-11101)
[»] scaffold0254 (1 HSPs)
scaffold0254 (3-178)||(17484-17659)
[»] scaffold0237 (1 HSPs)
scaffold0237 (3-178)||(10107-10282)
[»] scaffold0143 (2 HSPs)
scaffold0143 (3-178)||(32195-32370)
scaffold0143 (3-178)||(8862-9037)
[»] scaffold0089 (1 HSPs)
scaffold0089 (3-178)||(4969-5144)
[»] scaffold0792 (1 HSPs)
scaffold0792 (3-178)||(5785-5960)
[»] scaffold0547 (1 HSPs)
scaffold0547 (3-178)||(10769-10944)
[»] scaffold0336 (1 HSPs)
scaffold0336 (3-178)||(14473-14648)
[»] scaffold0322 (2 HSPs)
scaffold0322 (3-178)||(560-735)
scaffold0322 (3-178)||(10947-11122)
[»] scaffold0109 (1 HSPs)
scaffold0109 (3-178)||(24018-24193)
[»] scaffold0099 (1 HSPs)
scaffold0099 (3-178)||(41892-42078)
[»] scaffold0404 (1 HSPs)
scaffold0404 (33-166)||(12108-12241)
[»] scaffold0031 (1 HSPs)
scaffold0031 (115-178)||(16709-16772)
[»] scaffold0160 (1 HSPs)
scaffold0160 (120-178)||(32210-32266)
[»] scaffold0157 (1 HSPs)
scaffold0157 (115-166)||(3734-3785)
[»] scaffold0047 (1 HSPs)
scaffold0047 (123-166)||(87564-87607)


Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 60)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 5642872 - 5642697
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5642872 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 5642773  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
5642772 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 5642697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 18495801 - 18495976
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18495801 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 18495900  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18495901 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 18495976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 24729053 - 24728878
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24729053 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 24728954  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24728953 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 24728878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 34621602 - 34621427
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34621602 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 34621503  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34621502 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 34621427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 43083339 - 43083164
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43083339 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 43083240  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43083239 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 43083164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 11328721 - 11328546
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11328721 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 11328622  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
11328621 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 11328546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 13437759 - 13437934
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13437759 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 13437858  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
13437859 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 13437934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 22994193 - 22994368
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22994193 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 22994292  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
22994293 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 22994368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 31436548 - 31436373
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
31436548 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttct 31436449  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31436448 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 31436373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 37666562 - 37666737
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
37666562 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattatcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 37666661  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37666662 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 37666737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 40468626 - 40468801
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
40468626 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatattgttct 40468725  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
40468726 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 40468801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 2516146 - 2515971
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |    
2516146 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgtttt 2516047  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2516046 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 2515971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 3794625 - 3794450
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3794625 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 3794526  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
3794525 tgatgaacttagttaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 3794450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 13319906 - 13320081
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||    
13319906 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatattgttct 13320005  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13320006 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 13320081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 15753928 - 15754103
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||    
15753928 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccgttgtcggtaataatcttgctaggaacaccatatcgacagatgatgttgttct 15754027  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15754028 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 15754103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 28954861 - 28955036
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28954861 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 28954960  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
28954961 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 28955036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 30173553 - 30173378
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30173553 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 30173454  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
30173453 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 30173378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 30939719 - 30939544
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30939719 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 30939620  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
30939619 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 30939544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 31821483 - 31821658
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31821483 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 31821582  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
31821583 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 31821658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 37353719 - 37353894
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37353719 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 37353818  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
37353819 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 37353894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 37747405 - 37747580
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37747405 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 37747504  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
37747505 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 37747580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 8660551 - 8660726
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
8660551 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 8660650  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
8660651 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 8660726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 9545785 - 9545960
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
9545785 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctggtaacaccatatcgacagatgatgttgttct 9545884  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
9545885 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 9545960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 11554439 - 11554264
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
11554439 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 11554340  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
11554339 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 11554264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 13181869 - 13182044
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13181869 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 13181968  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
13181969 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 13182044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 15653833 - 15654008
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
15653833 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttattct 15653932  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||    
15653933 tgatgaacttagctaccacttgcttggtcacattggtataagacgctgcttcaacccacttggtaaagtagtcaat 15654008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 24974931 - 24974756
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||     
24974931 aattcttcacaaagagcttgcaccacattgttattcaggtttgtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttcc 24974832  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
24974831 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 24974756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 30157115 - 30156940
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
30157115 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 30157016  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
30157015 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 30156940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 32591350 - 32591525
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32591350 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 32591449  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
32591450 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 32591525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 33521464 - 33521289
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33521464 aattcttcacaaagagcttgcaccacattgttgttcaggttagtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 33521365  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
33521364 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 33521289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 33880212 - 33880037
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
33880212 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 33880113  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
33880112 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 33880037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 37760067 - 37759892
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
37760067 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatattgttct 37759968  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
37759967 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 37759892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 41679789 - 41679614
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
41679789 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtgataatcttgctgggaacaccatatcgacagatgatgttgttct 41679690  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||||    
41679689 tgataaacttagctaccacttgcttggttacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 41679614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 18123492 - 18123667
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
18123492 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 18123591  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
18123592 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 18123667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 28654327 - 28654152
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||    
28654327 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattatcggtaataatcttgctgggaacaccatatcgacagatgatattgttct 28654228  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
28654227 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 28654152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 33297612 - 33297437
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||    
33297612 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatattgttct 33297513  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||    
33297512 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttagtgaagtagtcaat 33297437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 33782569 - 33782394
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33782569 aattcttcacaaagagcttgcaccacattgttgttcaggtttgtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 33782470  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
33782469 tgatgaacttaactaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 33782394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 18370610 - 18370785
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
18370610 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgaggttgttct 18370709  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||    
18370710 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcgacccacttggtgaagtagtcaat 18370785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 23896959 - 23896784
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
23896959 aattcttcacaaagagcttgcaccacattgttgttcaggttagtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttct 23896860  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||    
23896859 tgatgaacttagctaccacttgcttggtcacattggtataagatgcagcttcgacccatttggtgaagtagtcaat 23896784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 30034512 - 30034337
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||    
30034512 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccgttgtcggtaataattttgctgggaacaccatatcgacagatgatgttgttct 30034413  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||    
30034412 tgataaacttagctaccacttgcttagtcacattggtataagatgccgcttcaacccatttggtaaagtagtcaat 30034337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 6879389 - 6879214
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||| |||||||| || |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||    
6879389 aattcttcacaaagagcttgtaccacattgttgttcaggttggtaccattgtcagtaataatcttgttgggaacaccatatcgacagatgatgttgttct 6879290  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
6879289 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 6879214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 9322560 - 9322385
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||    
9322560 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgttgggaacaccatatcgacagatgatgttgttct 9322461  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
9322460 tgataaacttggctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 9322385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 12137259 - 12137084
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| || || || |||||||||||||    
12137259 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccgtaccggcatatgatgttgttct 12137160  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
12137159 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 12137084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 23631053 - 23630878
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||| |||||||||||||||||||| || |||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||    
23631053 aattcttcgcaaagagcttgcaccacattgttgttcaggtttgtaccattgtcggtaatgatcttgctgggaacaccataccgacagatgatgttattct 23630954  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
23630953 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 23630878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 26485478 - 26485303
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| || || || |||||||||||||    
26485478 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccgtaccggcatatgatgttgttct 26485379  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
26485378 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 26485303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 25205362 - 25205187
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || || ||||| ||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||    
25205362 aattcttcacaaagagcttgcaccacattgttgtttaggttagtaccattgtcggtaatgatcttgctaggaacaccatatcgacatatgatgttgttct 25205263  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||    
25205262 tgatgaacttagctaccacttgcttagtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 25205187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 25269517 - 25269342
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || || ||||| ||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||    
25269517 aattcttcacaaagagcttgcaccacattgttgtttaggttagtaccattgtcggtaatgatcttgctaggaacaccatatcgacatatgatgttgttct 25269418  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||    
25269417 tgatgaacttagctaccacttgcttagtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 25269342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 132; E-Value: 8e-69
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 29886273 - 29886448
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||||||||||||  | || ||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||    
29886273 aattcttcacaaagagcttgcaccacattgctgtttaggttggtaccattgtcggtaatgatcttactgggaacaccatatcgacagatgatgttattct 29886372  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||    
29886373 tgatgaacttggctaccacttgcttggtcacattggtataagatgccgcttcaacccatttagtgaagtagtcaat 29886448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 85; E-Value: 9e-41
Query Start/End: Original strand, 86 - 178
Target Start/End: Complemental strand, 24588375 - 24588283
Alignment:
86 acagatgatgttgttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
24588375 acagatgatgttgttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 24588283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 103 - 178
Target Start/End: Complemental strand, 22893447 - 22893372
Alignment:
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||| |||||||||||||| || ||||||||||||||||| ||||||||||||||||| |||||||||||    
22893447 tgatgaacttggctaccacttgcttagttacattggtataagatgccgcttcaacccatttggtgaagtagtcaat 22893372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 45 - 178
Target Start/End: Original strand, 20387131 - 20387264
Alignment:
45 gtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtcacattggtataag 144  Q
    |||||||| || || || |||||| | || |||||||| ||||| ||||| ||||||||||| |||    | ||||| |||||||||||||||| |||||    
20387131 gtaccattatccgtgatgatcttgttagggacaccatagcgacatatgatattgttcttgataaaccggaccaccacctgcttggtcacattggcataag 20387230  T
145 atgctgcttcaacccatttggtaaagtagtcaat 178  Q
    | || ||||||||||| ||||| |||||||||||    
20387231 aagccgcttcaacccacttggtgaagtagtcaat 20387264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 40; E-Value: 0.00000000000006
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 350427 - 350490
Alignment:
115 ctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||| ||||||||||||| ||||||||| ||||| ||||||||||| |||||||||||    
350427 ctactacttgtttggtcacattggcataagatgccgcttcgacccatttggtgaagtagtcaat 350490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 40; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 24065362 - 24065441
Alignment:
99 ttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||| |||||  ||||||| |||||||||||||| | ||||||||| ||||||||||| ||||| || ||||||||    
24065362 ttcttgataaacttgactaccacctgcttggtcacattagcataagatgcagcttcaacccacttggtgaaatagtcaat 24065441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 34470586 - 34470507
Alignment:
99 ttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||| |||||  ||||||| |||||||||||||| | ||| ||||| ||||||||||| ||||| || ||||||||    
34470586 ttcttgataaacttgactaccacctgcttggtcacattagcataggatgcagcttcaacccacttggtgaaatagtcaat 34470507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 33 - 166
Target Start/End: Original strand, 3482333 - 3482466
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | ||||| |||||||||||| ||  |  | || || ||||||||||    
3482333 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgaggttgttcttgataaatctgaccactacctgcttggtca 3482432  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    ||||||  |||||||||||||||||||| |||||    
3482433 cattggcgtaagatgctgcttcaacccacttggt 3482466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 12889172 - 12889233
Alignment:
117 accacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||| | ||||||||  ||||||||||| ||||| || ||||||||    
12889172 accacttgcttggtcacattagcataagatgtggcttcaacccacttggtgaaatagtcaat 12889233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 36374179 - 36374237
Alignment:
120 acttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||| ||| ||||| || |||||||| || || |||||||||||    
36374179 acttgcttggtcacattggcatatgatgcggcctcaacccacttagtgaagtagtcaat 36374237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 36998833 - 36998891
Alignment:
120 acttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||| ||| ||||| || |||||||| || || |||||||||||    
36998833 acttgcttggtcacattggcatatgatgcggcctcaacccacttagtgaagtagtcaat 36998891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 5438439 - 5438500
Alignment:
117 accacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||| | ||| ||||| || |||||||| || || |||||||||||    
5438439 accacttgcttggtcacattagcatacgatgcggcctcaacccacttagtgaagtagtcaat 5438500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 3 - 43
Target Start/End: Complemental strand, 22893495 - 22893455
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggtt 43  Q
    ||||||||| ||||||||||||||||||| || ||||||||    
22893495 aattcttcataaagagcttgcaccacattgttgttcaggtt 22893455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 168; Significance: 3e-90; HSPs: 3)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 4358 - 4533
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4358 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 4457  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4458 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 4533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #2
Raw Score: 75; E-Value: 8e-35
Query Start/End: Original strand, 104 - 178
Target Start/End: Complemental strand, 24549 - 24475
Alignment:
104 gatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24549 gatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 24475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #3
Raw Score: 42; E-Value: 0.000000000000004
Query Start/End: Original strand, 3 - 59
Target Start/End: Original strand, 13974 - 14031
Alignment:
3 aattcttcacaaagagcttgcaccacatt-attattcaggttggtaccattgtcggta 59  Q
    |||||||||||||||||||||||||||||  || ||||||||||||||||||||||||    
13974 aattcttcacaaagagcttgcaccacattgtttgttcaggttggtaccattgtcggta 14031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 13026 - 12851
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13026 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 12927  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12926 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 12851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 28)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 12087863 - 12088038
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12087863 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 12087962  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12087963 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 12088038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 15772650 - 15772475
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15772650 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 15772551  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15772550 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 15772475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 14562700 - 14562525
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14562700 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 14562601  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
14562600 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 14562525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 16288028 - 16287853
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16288028 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 16287929  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
16287928 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 16287853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 19679523 - 19679348
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
19679523 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgttggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 19679424  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
19679423 tgatgaacttagctaccacttgcttggtcacatttgtataagatgctgcttcaacccatttggtaaagtagtcaat 19679348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 29834401 - 29834226
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
29834401 aattcttcacaaagagcttgcaccacattattgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcggcagatgatgttgttct 29834302  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
29834301 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 29834226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 31485011 - 31485186
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||    
31485011 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatattgttct 31485110  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
31485111 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 31485186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 33263810 - 33263635
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33263810 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 33263711  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
33263710 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 33263635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 44566060 - 44565885
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44566060 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 44565961  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
44565960 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 44565885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 2132400 - 2132575
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
2132400 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttattct 2132499  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
2132500 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 2132575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 19912302 - 19912477
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19912302 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 19912401  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||    
19912402 tgatgaacttagctaccacttgcttggtcacattggtataagacgctgcttcaacccacttggtgaagtagtcaat 19912477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 21343311 - 21343486
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
21343311 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 21343410  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
21343411 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 21343486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 27604045 - 27604220
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27604045 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 27604144  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
27604145 taatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 27604220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 28357092 - 28357267
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||    
28357092 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcagtaatgatcttgctgggaacaccatatcgacagatgatgttgttct 28357191  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
28357192 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 28357267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 9359701 - 9359526
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
9359701 aattcttcacaaagagcttgcaccacattgttgttcaggtttgtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttattct 9359602  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
9359601 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 9359526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 22137986 - 22137811
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
22137986 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaactccatatcgacagatgatgttgttct 22137887  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
22137886 tgatgaacttagctacaacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 22137811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 33247446 - 33247271
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||    
33247446 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcagtaataatcttgctgggaacaccataccgacagatgatgttgttct 33247347  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||    
33247346 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcctcaacccacttggtgaagtagtcaat 33247271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 31359604 - 31359429
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||||||    
31359604 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttactgggaataccatatcggcagatgatgttgttct 31359505  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
31359504 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 31359429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 19656480 - 19656656
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacaga-tgatgttgttc 101  Q
    |||||||||||||| |||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||    
19656480 aattcttcacaaagtgcttgcaccacattgttgttcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagagtgatgttgttc 19656579  T
102 ttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
19656580 ttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 19656656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 19693175 - 19692999
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacaga-tgatgttgttc 101  Q
    |||||||||||||| |||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||    
19693175 aattcttcacaaagtgcttgcaccacattgttgttcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagagtgatgttgttc 19693076  T
102 ttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
19693075 ttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 19692999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 18795780 - 18795605
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||  || |||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||    
18795780 aattcttcacaaagagcttgcaccacatcgttgttcaggtttgtaccattgtcggtaatgattttgctgggaacaccatatcgacagatgatgttgttct 18795681  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
18795680 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 18795605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 18714560 - 18714385
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||| |||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||     
18714560 aattcttcgcaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttcc 18714461  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||    
18714460 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttccacccacttggtgaagtagtcaat 18714385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 19203502 - 19203677
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| || || || |||||||||||||    
19203502 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccgtaccggcatatgatgttgttct 19203601  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
19203602 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 19203677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 22076065 - 22076240
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||| ||||||||||| || | ||||||||| || ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||    
22076065 aattcttcacatagagcttgcactacgtcattattcagattagtaccattgtcagtaatgatcttgctgggaacaccatatcgacagatgatgttgttct 22076164  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||| ||| ||||| |||| |||||||||||| |||||||||||    
22076165 tgatgaacttagctaccacttgcttggtcacattggcataggatgcagctttaacccatttggtgaagtagtcaat 22076240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 45 - 178
Target Start/End: Complemental strand, 16770333 - 16770200
Alignment:
45 gtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtcacattggtataag 144  Q
    |||||||| || || ||||||||| | || |||||||| ||||| ||||| ||||||||||| |||    | ||||| |||||||||||||| | |||||    
16770333 gtaccattatccgtgataatcttgttagggacaccatagcgacatatgatattgttcttgataaaccggaccaccacctgcttggtcacattagcataag 16770234  T
145 atgctgcttcaacccatttggtaaagtagtcaat 178  Q
    | || ||||||||||| ||||| |||||||||||    
16770233 aagccgcttcaacccacttggtgaagtagtcaat 16770200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 166
Target Start/End: Complemental strand, 22413960 - 22413827
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | |||||||||||||||||| ||  |  | || || ||||||||||    
22413960 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgatgttgttcttgataaatctgaccactacctgcttggtca 22413861  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    ||||||  |||||||||||||||||||| |||||    
22413860 cattggcgtaagatgctgcttcaacccacttggt 22413827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 33 - 166
Target Start/End: Complemental strand, 14214061 - 14213928
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | ||||| |||||||||||| ||  |  | || || ||||||||||    
14214061 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgaggttgttcttgataaatctgaccactacctgcttggtca 14213962  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    ||||||  |||||||||||||||||||| |||||    
14213961 cattggcgtaagatgctgcttcaacccacttggt 14213928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 72 - 166
Target Start/End: Complemental strand, 19846146 - 19846052
Alignment:
72 ggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggt 166  Q
    |||||||| || || | |||||||||||||||||| ||  |  | || || ||||||||| ||||||  |||||||||||||||||||| |||||    
19846146 ggaacaccgtagcggctgatgatgttgttcttgataaatctgaccactacctgcttggtctcattggcttaagatgctgcttcaacccacttggt 19846052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 43)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 31128981 - 31128806
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31128981 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 31128882  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31128881 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 31128806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 2105227 - 2105402
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2105227 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 2105326  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
2105327 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 2105402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 3450380 - 3450205
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3450380 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 3450281  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
3450280 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 3450205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 4204463 - 4204288
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
4204463 aattcttcacaaagagcctgcaccacattattattcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 4204364  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
4204363 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 4204288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 31559454 - 31559629
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
31559454 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttct 31559553  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31559554 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 31559629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 39208203 - 39208378
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39208203 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 39208302  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
39208303 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 39208378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 45392294 - 45392119
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45392294 aattcttcacaaagagcttgcaccacattgttgttcaggttcgtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 45392195  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45392194 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 45392119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 11445961 - 11445786
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||    
11445961 aattcttcacaaagagcttgcaccacattattgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttattct 11445862  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
11445861 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 11445786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 24587598 - 24587773
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24587598 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 24587697  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
24587698 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 24587773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 45736381 - 45736206
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45736381 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 45736282  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||| |||||||||||    
45736281 tgatgaacttagctaccacttgcttggtcacattagtataaggtgctgcttcaacccacttggtgaagtagtcaat 45736206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 3 - 175
Target Start/End: Complemental strand, 26517866 - 26517694
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26517866 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 26517767  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtc 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||    
26517766 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtc 26517694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 5153158 - 5152983
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||    
5153158 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccgtatcgatagatgatgttgttct 5153059  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
5153058 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 5152983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 5163457 - 5163282
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
5163457 aattcttcacaaagagcttgcaccacattgttattcaggtttgtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 5163358  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
5163357 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 5163282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 11419843 - 11420018
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
11419843 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 11419942  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
11419943 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 11420018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 26532937 - 26533112
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| ||||    
26532937 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgagagatgatgttattct 26533036  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
26533037 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 26533112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 4140310 - 4140485
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
4140310 aattcttcacaaagagcttgtaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagacgatgttgttct 4140409  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
4140410 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 4140485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 5142404 - 5142579
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5142404 aattcttcacaaagagcttgcaccacattgttgttcagtttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 5142503  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||    
5142504 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttagtgaagtagtcaat 5142579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 16513494 - 16513669
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
16513494 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcc 16513593  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
     ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||    
16513594 ggatgaacttagctaccacttgcttggtcacattggtataagatgccgcttcaacccacttggtgaagtagtcaat 16513669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 26270150 - 26270325
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||    
26270150 aattcttcacaaagagcttgtaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgatagacgatgttgttct 26270249  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
26270250 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 26270325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 26510760 - 26510935
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
26510760 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 26510859  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
26510860 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 26510935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 26664978 - 26665153
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
26664978 aattcttcacaaagagcttgcaccacattgttgttcaggttagtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 26665077  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
26665078 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 26665153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 26680170 - 26680345
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
26680170 aattcttcacaaagagcttgcaccacattgttgttcaggttagtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 26680269  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
26680270 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 26680345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 2159648 - 2159473
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||| |||||||||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
2159648 aattcttcgcaaagagcttgcaccacattgttgttcaggtttgtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 2159549  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
2159548 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 2159473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 31085686 - 31085861
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||    
31085686 aattcttcacaaagagcttgcaccacattgttgttcaagttggtaccattgtcagtaatgatcttgctgggaacaccatatcgacagatgatgttgttct 31085785  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
31085786 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 31085861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 10911933 - 10912108
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||| |||||||||||||||||||| || |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||    
10911933 aattcttcgcaaagagcttgcaccacattgttgttcaggtttgtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttattct 10912032  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
10912033 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 10912108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 16746581 - 16746756
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||    
16746581 aattcttcacagagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcggcatatgatgttgttct 16746680  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
16746681 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 16746756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 26440331 - 26440156
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
26440331 aattcttcacaaagagcttgcaccacattgttgttcaagttggtaccattgtcggtaataatcttgctgggaacaccatatcgacaaatgatgttgttct 26440232  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
26440231 tgataaacttagctaccacctgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 26440156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 2778328 - 2778153
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||    
2778328 aattcttcacaaagagcttgcaccacattgttgttcaggtttgtaccattgtcggtaatgatcttgctgggaactccatatcgacatatgatgttgttct 2778229  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
2778228 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 2778153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 26314912 - 26315087
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| || || || |||||||||||||    
26314912 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccgtaccggcatatgatgttgttct 26315011  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
26315012 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 26315087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 10846694 - 10846519
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||     
10846694 aattctttacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttcc 10846595  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||| ||||||| |||||||||||    
10846594 tgatgaacttggctaccacttgcttggtaacattggtataagatgccgcttcaaccaatttggtgaagtagtcaat 10846519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 16445070 - 16445245
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||     
16445070 aattcttcataaagagcttgcaccacattgttattcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttcc 16445169  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||| |||||||||||||| || ||||||| ||||||||| ||||||||||||||||| |||||||||||    
16445170 tgatgaacttggctaccacttgcttagttacattggcataagatgccgcttcaacccatttggtgaagtagtcaat 16445245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 5 - 174
Target Start/End: Complemental strand, 16046387 - 16046218
Alignment:
5 ttcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttg 104  Q
    |||||| || ||||||||||||||||| || |||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||    
16046387 ttcttcgcagagagcttgcaccacattgttgttcaggttagtaccattgtcggtaatgatcttgctgggaacaccgtatcgacagatgatgttgttcctg 16046288  T
105 atgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagt 174  Q
    |||||||| |||||||||||||| || ||||||||||||||||| ||||||||||||||||| |||||||    
16046287 atgaacttggctaccacttgcttagttacattggtataagatgccgcttcaacccatttggtgaagtagt 16046218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 50; E-Value: 7e-20
Query Start/End: Original strand, 45 - 178
Target Start/End: Original strand, 1891705 - 1891838
Alignment:
45 gtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtcacattggtataag 144  Q
    |||||||| || || ||||||||| | || |||||||| ||||| ||||| ||||||||||| |||    | ||||| |||||||||||||||| |||||    
1891705 gtaccattatccgtgataatcttgttagggacaccatagcgacatatgatattgttcttgataaaccggaccaccacctgcttggtcacattggcataag 1891804  T
145 atgctgcttcaacccatttggtaaagtagtcaat 178  Q
    | || ||||||||||| ||||| |||||||||||    
1891805 aagccgcttcaacccacttggtgaagtagtcaat 1891838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 796707 - 796786
Alignment:
99 ttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||| |||||  ||||||| |||||||||||||| | ||||||||| ||||||||||| ||||| || ||||||||    
796707 ttcttgataaacttgactaccacctgcttggtcacattagcataagatgcagcttcaacccacttggtgaaatagtcaat 796786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 166
Target Start/End: Original strand, 16125936 - 16126069
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | |||||||||||||||||| ||  |  | || || ||||||||||    
16125936 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgatgttgttcttgataaatctgaccactacctgcttggtca 16126035  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    ||||||  |||||||||||||||||||| |||||    
16126036 cattggcgtaagatgctgcttcaacccacttggt 16126069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 166
Target Start/End: Complemental strand, 29091536 - 29091403
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | |||||||||||||||||| ||  |  | || || ||||||||||    
29091536 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgatgttgttcttgataaatctgaccactacctgcttggtca 29091437  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    ||||||  |||||||||||||||||||| |||||    
29091436 cattggcgtaagatgctgcttcaacccacttggt 29091403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 33 - 166
Target Start/End: Complemental strand, 2558555 - 2558422
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | ||||| |||||||||||| ||  |  | || || ||||||||||    
2558555 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgaggttgttcttgataaatctgaccactacctgcttggtca 2558456  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    ||||||  |||||||||||||||||||| |||||    
2558455 cattggcgtaagatgctgcttcaacccacttggt 2558422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 33 - 166
Target Start/End: Complemental strand, 15195103 - 15194970
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | ||||| |||||||||||| ||  |  | || || ||||||||||    
15195103 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgaggttgttcttgataaatctgaccactacctgcttggtca 15195004  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    ||||||  |||||||||||||||||||| |||||    
15195003 cattggcgtaagatgctgcttcaacccacttggt 15194970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 33 - 166
Target Start/End: Complemental strand, 16239436 - 16239303
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | ||||||||||||| |||| ||  |  | || || ||||||||||    
16239436 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgatgttgttcatgataaatctgaccactacctgcttggtca 16239337  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    ||||||  |||||||||||||||||||| |||||    
16239336 cattggcgtaagatgctgcttcaacccacttggt 16239303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 16285563 - 16285642
Alignment:
99 ttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||| |||||  ||||||| || ||||||||||| | ||||||| | || |||||||||||||| || ||||||||    
16285563 ttcttgataaacttgactaccacctgtttggtcacattagcataagatacagcctcaacccatttggtgaaatagtcaat 16285642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 9471249 - 9471191
Alignment:
120 acttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||| ||| ||||| || |||||||| || || |||||||||||    
9471249 acttgcttggtcacattggcatatgatgcggcctcaacccacttagtgaagtagtcaat 9471191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 16391639 - 16391697
Alignment:
120 acttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||| ||| ||||| || |||||||| || || |||||||||||    
16391639 acttgcttggtcacattggcatatgatgcggcctcaacccacttagtgaagtagtcaat 16391697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 30368148 - 30368209
Alignment:
117 accacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||| ||||||||||||| ||| ||||| || |||||||| || || |||||||||||    
30368148 accacttgtttggtcacattggcatatgatgcggcctcaacccacttagtgaagtagtcaat 30368209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 52)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 4530359 - 4530184
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4530359 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 4530260  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4530259 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 4530184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 4540896 - 4541071
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4540896 aattcttcacaaagaacttgcaccacattattgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 4540995  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4540996 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 4541071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 4777954 - 4777779
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4777954 aattcttcacaaagagcttgcaccacattattgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 4777855  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
4777854 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaatccatttggtaaagtagtcaat 4777779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 8900825 - 8901000
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8900825 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 8900924  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8900925 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 8901000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 27012805 - 27012630
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27012805 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 27012706  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27012705 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 27012630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 28212528 - 28212353
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28212528 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 28212429  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28212428 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 28212353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 3 - 177
Target Start/End: Original strand, 4719257 - 4719431
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4719257 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 4719356  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaa 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4719357 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaa 4719431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 27199259 - 27199084
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
27199259 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatattgttct 27199160  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
27199159 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 27199084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 27249975 - 27250150
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
27249975 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatattgttct 27250074  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
27250075 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 27250150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 28165565 - 28165390
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28165565 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 28165466  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
28165465 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 28165390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 13294073 - 13294248
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13294073 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 13294172  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
13294173 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 13294248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 16939149 - 16939324
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16939149 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 16939248  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
16939249 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 16939324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 24300879 - 24301054
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24300879 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 24300978  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
24300979 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 24301054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 26773749 - 26773924
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
26773749 aattcttcacaaagagcttgcaccacattattgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgtttt 26773848  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
26773849 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 26773924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 27490207 - 27490032
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
27490207 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctaggaacaccatatcgacagatgatgttgttct 27490108  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
27490107 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 27490032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 4762837 - 4762662
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||    
4762837 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatattgttct 4762738  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4762737 tgatgaacttaactaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 4762662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 13519316 - 13519491
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
13519316 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 13519415  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
13519416 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 13519491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 15407655 - 15407830
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
15407655 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgctgttct 15407754  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||    
15407755 tgatgaacttagctaccacttgcttggtcacattggtataagatgatgcttcaacccacttggtgaagtagtcaat 15407830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 15419442 - 15419617
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
15419442 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgctgttct 15419541  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||    
15419542 tgatgaacttagctaccacttgcttggtcacattggtataagatgatgcttcaacccacttggtgaagtagtcaat 15419617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 16679214 - 16679039
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16679214 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 16679115  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||    
16679114 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcgacccacttggtgaagtagtcaat 16679039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 26111534 - 26111709
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26111534 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 26111633  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||    
26111634 tgatgaacttagctaccacttgcttggtcacattagtataagatgctgcttcaacccacttggtgaagtagtcaat 26111709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 26790890 - 26790715
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||    
26790890 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccatcgtcggtaatgatcttgctgggaacaccatatcgacagatgatattgttct 26790791  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26790790 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 26790715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 27357232 - 27357407
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27357232 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 27357331  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||| ||||| |||||||||||    
27357332 tgatgaacttagctaccacttgcttggtcacattagtataaggtgctccttcaacccacttggtgaagtagtcaat 27357407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 29506490 - 29506315
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
29506490 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatattgttct 29506391  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
29506390 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 29506315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 30553138 - 30553313
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30553138 aattcttcacaaagagcttgcaccacattgttgttcaggttagtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 30553237  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
30553238 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 30553313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 11 - 178
Target Start/End: Original strand, 33371561 - 33371728
Alignment:
11 acaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaac 110  Q
    ||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33371561 acaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaac 33371660  T
111 ttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
33371661 ttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 33371728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 34459628 - 34459803
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34459628 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 34459727  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||    
34459728 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcgacccacttggtgaagtagtcaat 34459803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 14140516 - 14140691
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14140516 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 14140615  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||| |||||||||||    
14140616 tgatgaacttagctaccacttgcttggtcacattagtataaggtgctgcttcaacccacttggtgaagtagtcaat 14140691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 22930006 - 22930181
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||     
22930006 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacaaatgatgttgttcc 22930105  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
22930106 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 22930181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 23852451 - 23852626
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||     
23852451 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacaaatgatgttgttcc 23852550  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
23852551 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 23852626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 24868790 - 24868615
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
24868790 aattcttcacaaagagcttacaccacattgttattcaggttggtaccattgtcggtaataatcttgcggggaacaccatatcgacagatgatgttgttct 24868691  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||    
24868690 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtaatcaat 24868615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 27062580 - 27062405
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27062580 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 27062481  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||    
27062480 tgataaacttagctaccacttgcttggtcacattggcataagatgctgcttcaacccacttggtgaagtagtcaat 27062405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 27184003 - 27183828
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||  || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
27184003 aattcttcacaaagagcttgcaccacatcgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 27183904  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
27183903 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 27183828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 27265236 - 27265411
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||  || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
27265236 aattcttcacaaagagcttgcaccacatcgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 27265335  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
27265336 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 27265411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 27024211 - 27024036
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
27024211 aattcttcacaaagagcttgcaccacattgttgttcaggtttgtaccattgtcggtaatgatcttgctgggaacaccatatcgacaaatgatgttgttct 27024112  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
27024111 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 27024036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 29554632 - 29554456
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
29554632 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 29554533  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaaccca-tttggtaaagtagtcaat 178  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||| |||||||||||    
29554532 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacgttggtgaagtagtcaat 29554456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 137; E-Value: 8e-72
Query Start/End: Original strand, 3 - 147
Target Start/End: Complemental strand, 26925844 - 26925700
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26925844 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 26925745  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatg 147  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
26925744 tgatgaacttagctaccacttgcttggtcacattggtataagatg 26925700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 16754895 - 16754720
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||| || ||||||||||||||||||||||| |||||||||| ||    
16754895 aattcttcacaaagagcttgcaccacattgttgttcaggtttgtaccattgtcggtaatgattttgctgggaacaccatatcgacatatgatgttgtcct 16754796  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
16754795 taatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 16754720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 29578088 - 29577913
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||||||| || || || |||||||||||||    
29578088 aattcttcacaaagagcttgcaccacgttgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccgtaccggcatatgatgttgttct 29577989  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
29577988 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 29577913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 132; E-Value: 8e-69
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 27285486 - 27285661
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
27285486 aattcttcacaaagagcttgcaccacattgttgttcagattggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttct 27285585  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||| || ||||||||||| ||||||||||||||||| || ||||| ||||||||||| |||||||||||    
27285586 tgatgaacttggccaccacttgcttagtcacattggtataagacgcagcttcgacccatttggtgaagtagtcaat 27285661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 132; E-Value: 8e-69
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 27624833 - 27625008
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||| ||||| || |||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||     
27624833 aattcttcacaaagagcttgcactacattgttgttcaagttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttcc 27624932  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||| ||||||||||||||||| ||||||||||||||||| ||||| ||||||||||| |||||||||||    
27624933 tgatgaacttggctaccacttgcttggttacattggtataagatgcagcttcgacccatttggtgaagtagtcaat 27625008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 17087565 - 17087740
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||  |||||||||||||||||||| || |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||     
17087565 aattcttttcaaagagcttgcaccacattgttgttcaggttggtaccattgtctgtaatgatcttgctgggaacaccatatcgacagataatgttgttcc 17087664  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||| | ||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||    
17087665 tgatgaacctggctaccacttgcttggttacattggtataggatgccgcttcaacccatttggtaaagtagtcaat 17087740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 112; E-Value: 7e-57
Query Start/End: Original strand, 3 - 166
Target Start/End: Complemental strand, 20173621 - 20173458
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||| ||||| || |||| ||||||||||||||  || ||||||||| |||||||||||||||||||||||||||||||||    
20173621 aattcttcacaaagagcttgcactacattgttgttcaagttggtaccattgttagtgataatcttgttgggaacaccatatcgacagatgatgttgttct 20173522  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggt 166  Q
    |||| ||||| ||||||||||||||||| ||||||| ||||||||| |||||||||||||||||    
20173521 tgataaacttggctaccacttgcttggttacattggcataagatgcagcttcaacccatttggt 20173458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 112; E-Value: 7e-57
Query Start/End: Original strand, 3 - 166
Target Start/End: Original strand, 22162370 - 22162533
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||| ||||| || |||| ||||||||||||||  || ||||||||| |||||||||||||||||||||||||||||||||    
22162370 aattcttcacaaagagcttgcactacattgttgttcaagttggtaccattgttagtgataatcttgttgggaacaccatatcgacagatgatgttgttct 22162469  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggt 166  Q
    |||| ||||| ||||||||||||||||| ||||||| ||||||||| |||||||||||||||||    
22162470 tgataaacttggctaccacttgcttggttacattggcataagatgcagcttcaacccatttggt 22162533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 30 - 178
Target Start/End: Complemental strand, 27546925 - 27546777
Alignment:
30 ttattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttgg 129  Q
    ||||| ||||| || |||||||| || || ||||||||| | || || ||||| ||||| ||||| ||||||||||| |||    | |||||||||||||    
27546925 ttattgttcagattcgtaccattatccgtgataatcttgttagggacgccatagcgacatatgatattgttcttgataaaccggaccaccacttgcttgg 27546826  T
130 tcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||| |||||| || ||||||||||| ||||| |||||||||||    
27546825 tcacattggcataagaagccgcttcaacccacttggtgaagtagtcaat 27546777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 52; E-Value: 4e-21
Query Start/End: Original strand, 75 - 174
Target Start/End: Complemental strand, 25708932 - 25708833
Alignment:
75 acaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagt 174  Q
    |||||||| ||||| ||||| |||||||||||||||    |||||||||||||||||||||||| ||||||||| ||||||||||| || || |||||||    
25708932 acaccatagcgacatatgatattgttcttgatgaaccggactaccacttgcttggtcacattggcataagatgccgcttcaacccacttagtgaagtagt 25708833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 160
Target Start/End: Original strand, 21363814 - 21363941
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | |||||||||||||||||| ||  |  | || || ||||||||||    
21363814 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgatgttgttcttgataaatctgaccactacctgcttggtca 21363913  T
133 cattggtataagatgctgcttcaaccca 160  Q
    ||||||  ||||||||||||||||||||    
21363914 cattggcgtaagatgctgcttcaaccca 21363941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 160
Target Start/End: Original strand, 23967796 - 23967923
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | |||||||||||||||||| ||  |  | || || ||||||||||    
23967796 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgatgttgttcttgataaatctgaccactacctgcttggtca 23967895  T
133 cattggtataagatgctgcttcaaccca 160  Q
    ||||||  ||||||||||||||||||||    
23967896 cattggcgtaagatgctgcttcaaccca 23967923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 33 - 166
Target Start/End: Complemental strand, 18121489 - 18121356
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | ||||| |||||||||||| ||  |  | || || ||||||||||    
18121489 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgaggttgttcttgataaatctgaccactacctgcttggtca 18121390  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    ||||||  |||||||||||||||||||| |||||    
18121389 cattggcgtaagatgctgcttcaacccacttggt 18121356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 33 - 166
Target Start/End: Original strand, 18210845 - 18210978
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | ||||| |||||||||||| ||  |  | || || ||||||||||    
18210845 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgaggttgttcttgataaatctgaccactacctgcttggtca 18210944  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    ||||||  |||||||||||||||||||| |||||    
18210945 cattggcgtaagatgctgcttcaacccacttggt 18210978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 26923314 - 26923276
Alignment:
140 ataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||| ||||| |||||||||||    
26923314 ataagatgctgcttcaacccacttggtgaagtagtcaat 26923276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 9134613 - 9134674
Alignment:
117 accacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||| | ||| ||||| || |||||||| || || |||||||||||    
9134613 accacttgcttggtcacattagcatacgatgcggcctcaacccacttagtgaagtagtcaat 9134674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 32)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 30758850 - 30758675
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30758850 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 30758751  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30758750 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 30758675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 17018136 - 17017961
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17018136 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 17018037  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||    
17018036 tgatgaacttagctaccacttgcttggtcacattggtataagatgccgcttcaacccatttggtgaagtagtcaat 17017961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 54838481 - 54838306
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
54838481 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtgataatcttgctgggaacaccatatcgacagatgatgttgttct 54838382  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
54838381 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 54838306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 5699625 - 5699450
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5699625 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 5699526  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
5699525 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 5699450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 6574948 - 6574773
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
6574948 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 6574849  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
6574848 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 6574773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 18312357 - 18312532
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18312357 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 18312456  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
18312457 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 18312532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 27158496 - 27158671
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27158496 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 27158595  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
27158596 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 27158671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 39855727 - 39855552
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39855727 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 39855628  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
39855627 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 39855552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 14103633 - 14103458
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
14103633 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatattgttct 14103534  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
14103533 tgatgaatttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 14103458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 14670103 - 14669928
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
14670103 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttct 14670004  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
14670003 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 14669928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 18795793 - 18795968
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
18795793 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctaggaacaccatatcgacagatgatgttgttct 18795892  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
18795893 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtaatcaat 18795968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 21974791 - 21974616
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
21974791 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 21974692  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
21974691 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 21974616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 24587540 - 24587715
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
24587540 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgtttt 24587639  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
24587640 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 24587715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 31121691 - 31121866
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
31121691 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 31121790  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
31121791 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 31121866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 34184139 - 34184314
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34184139 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 34184238  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
34184239 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 34184314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 40100816 - 40100991
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
40100816 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 40100915  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
40100916 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 40100991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 14754671 - 14754846
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
14754671 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttattct 14754770  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
14754771 tgatgaacttagccaccacctgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 14754846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 20333600 - 20333775
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||    
20333600 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttattct 20333699  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
20333700 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 20333775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 24117752 - 24117577
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
24117752 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 24117653  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
24117652 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 24117577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 33668979 - 33669154
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||    
33668979 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttactgggaacaccatatcggcagatgatgttgttct 33669078  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
33669079 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 33669154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 1905344 - 1905169
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
1905344 aattcttcacaaagagcttacaccacattgttattcaggttagtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttct 1905245  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||    
1905244 tgatgaacttagctaccacgtgcttggtcacattggtataagatgccgcttcaacccatttggtgaagtagtcaat 1905169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 5010965 - 5010790
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
5010965 aattcttcacaaagagcttgcaccacattgttgttcaagttagtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 5010866  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
5010865 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 5010790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 15277806 - 15277981
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||     
15277806 aattctttacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacaaatgatgttgttcc 15277905  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||    
15277906 tgatgaacttggctaccacttgcttggttacattggtataagatgccgcttcaacccatttggtgaagtagtcaat 15277981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 36339696 - 36339871
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||| ||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||    
36339696 aattcttcacaaagagcttgcaccacattgttgttcaagttggtaccattgtcagtaatgatcttgctgggaacaccatatcgacatatgatgttgttct 36339795  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||    
36339796 tgataaacttagctaccacttgcttggtcacattggtataagacgctgcttcaacccacttggtgaagtagtcaat 36339871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 15232906 - 15232731
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||| || ||||||||||||||||| || ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||     
15232906 aattcttcgcagagagcttgcaccacattgttgttcagattagtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttcc 15232807  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||| |||||||||||||| || ||||||||||||||||| ||||||||||||||||| |||||||||||    
15232806 tgatgaacttggctaccacttgcttagttacattggtataagatgccgcttcaacccatttggtgaagtagtcaat 15232731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 112; E-Value: 7e-57
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 15381422 - 15381597
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||| |||| |||||| || | ||||||||| || ||||| ||||  ||||| ||||||||||||||||||||||||||||||||||||||||    
15381422 aattcttcacatagaggttgcactacgtcattattcagattagtaccgttgtaagtaatgatcttgctgggaacaccatatcgacagatgatgttgttct 15381521  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||| |||||||||||    
15381522 tgataaacttagctaccacttgcttggtcacattggcataggatgcagcttcaacccatttggtgaagtagtcaat 15381597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 30 - 178
Target Start/End: Original strand, 1880329 - 1880477
Alignment:
30 ttattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttgg 129  Q
    ||||| ||||| || |||||||| || || ||||||||| | || || ||||| ||||| ||||| ||||||||||| |||  | | |||||||||||||    
1880329 ttattgttcagattcgtaccattatccgtgataatcttgttagggacgccatagcgacatatgatattgttcttgataaaccgaaccaccacttgcttgg 1880428  T
130 tcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||  ||||| || ||||||||||| ||||| |||||||||||    
1880429 tcacattggcgtaagacgccgcttcaacccacttggtgaagtagtcaat 1880477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 40; E-Value: 0.00000000000006
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 22144884 - 22144947
Alignment:
115 ctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||| ||||||||||||| ||||||||| ||||| ||||||||||| |||||||||||    
22144884 ctactacttgtttggtcacattggcataagatgccgcttcgacccatttggtgaagtagtcaat 22144947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 166
Target Start/End: Original strand, 14724032 - 14724165
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | |||||||||||||||||| ||  |  | || || ||||||||||    
14724032 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgatgttgttcttgataaatctgaccactacctgcttggtca 14724131  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    ||||||  |||||||||||||||||||| |||||    
14724132 cattggcgtaagatgctgcttcaacccacttggt 14724165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 166
Target Start/End: Complemental strand, 19769375 - 19769242
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | |||||||||||||||||| ||  |  | || || ||||||||||    
19769375 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgatgttgttcttgataaatctgaccactacctgcttggtca 19769276  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    ||||||  |||||||||||||||||||| |||||    
19769275 cattggcgtaagatgctgcttcaacccacttggt 19769242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 55786102 - 55786023
Alignment:
99 ttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||| |||||  |||||||||| ||||||||||| | ||| ||||| ||||||||||| ||||| || ||||||||    
55786102 ttcttgataaacttgactaccacttgtttggtcacattagcataggatgcagcttcaacccacttggtgaaatagtcaat 55786023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 115 - 166
Target Start/End: Complemental strand, 12517177 - 12517126
Alignment:
115 ctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggt 166  Q
    |||| ||||| ||||||||||||| ||||||||||||||  |||||||||||    
12517177 ctactacttgtttggtcacattggcataagatgctgctttgacccatttggt 12517126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 65)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 51787061 - 51786886
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51787061 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 51786962  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51786961 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 51786886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 5716111 - 5715936
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
5716111 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacaaatgatgttgttct 5716012  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
5716011 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 5715936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 5727021 - 5726846
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
5727021 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacaaatgatgttgttct 5726922  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
5726921 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 5726846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 5765347 - 5765522
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
5765347 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacaaatgatgttgttct 5765446  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
5765447 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 5765522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 6537964 - 6538139
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
6537964 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattatcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 6538063  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6538064 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 6538139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 8284692 - 8284867
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8284692 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 8284791  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||    
8284792 tgatgaacttagctaccacttgcttggtcacattggtataagatgccgcttcaacccatttggtgaagtagtcaat 8284867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 18247779 - 18247604
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
18247779 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatattgttct 18247680  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
18247679 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 18247604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 20572065 - 20572240
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
20572065 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacaaatgatgttgttct 20572164  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
20572165 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 20572240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 22866070 - 22866245
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22866070 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 22866169  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
22866170 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 22866245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 22881129 - 22881304
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22881129 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 22881228  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
22881229 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtgaagtagtcaat 22881304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 28344215 - 28344040
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28344215 aattcttcgcaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 28344116  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28344115 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 28344040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 31031458 - 31031633
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31031458 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 31031557  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
31031558 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 31031633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 31959677 - 31959852
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31959677 aattcttcacaaagagcttgcaccacattgttgttcagattggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 31959776  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31959777 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 31959852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 32444189 - 32444014
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32444189 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 32444090  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
32444089 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 32444014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 4688693 - 4688518
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4688693 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 4688594  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
4688593 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 4688518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 4726668 - 4726493
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4726668 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 4726569  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
4726568 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 4726493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 7078244 - 7078069
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7078244 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 7078145  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
7078144 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 7078069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 15887927 - 15888102
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15887927 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 15888026  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
15888027 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 15888102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 20071078 - 20070903
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20071078 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 20070979  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
20070978 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 20070903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 28026319 - 28026144
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28026319 aattcttcacaaaaagcttgcaccacattgttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 28026220  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
28026219 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 28026144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 4341898 - 4342073
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
4341898 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatattgttct 4341997  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
4341998 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 4342073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 4421953 - 4421778
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4421953 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 4421854  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
4421853 tgatgaacttaactaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 4421778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 4628823 - 4628648
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
4628823 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttattct 4628724  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
4628723 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 4628648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 10401182 - 10401007
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10401182 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 10401083  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||    
10401082 tgatgaacttagctaccacttgcttggtcacattggtataaaatgctgcttcaacccacttggtgaagtagtcaat 10401007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 15736316 - 15736491
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
15736316 aattcttcacaaagagcttgcaccacattgttattcaggtttgtaccattgtcggtaataatcttactgggaacaccatatcgacagatgatgttgttct 15736415  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
15736416 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 15736491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 18335668 - 18335493
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
18335668 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 18335569  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
18335568 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 18335493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 22382800 - 22382975
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||| |||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22382800 aatttttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 22382899  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
22382900 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 22382975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 24333201 - 24333026
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
24333201 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacatatgatgttgttct 24333102  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
24333101 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 24333026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 29143978 - 29144153
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29143978 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 29144077  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||    
29144078 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttagtgaagtagtcaat 29144153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 47028491 - 47028316
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47028491 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 47028392  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||    
47028391 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttagtgaagtagtcaat 47028316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 5018752 - 5018577
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
5018752 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatattgttct 5018653  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
5018652 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 5018577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 5591579 - 5591754
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
5591579 aattcttcacaaagagcttgcaccacgttgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatattgttct 5591678  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
5591679 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 5591754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 5657172 - 5656997
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
5657172 aattcttcacaaagagcttgcaccacattgttgttcaggtttgtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttct 5657073  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
5657072 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 5656997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 11105581 - 11105756
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
11105581 aattcttcacaaagagcttgcaccacattgttattcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 11105680  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||| |||||||||||    
11105681 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttccatccacttggtgaagtagtcaat 11105756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 17980171 - 17980346
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||||||||| |||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
17980171 aattcttcacaaagggcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 17980270  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
17980271 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 17980346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 18230234 - 18230059
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
18230234 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 18230135  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||    
18230134 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaatccacttggtgaagtagtcaat 18230059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 18287575 - 18287750
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
18287575 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttattct 18287674  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
18287675 tgatgaacttagccaccacctgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 18287750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 18302876 - 18303051
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
18302876 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttattct 18302975  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
18302976 tgatgaacttagccaccacctgcttggtcacattggtataagatgctgcttcaacccacttggtaaagtagtcaat 18303051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 21679741 - 21679566
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21679741 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 21679642  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||    
21679641 tgataaacttagctaccacttgcttggtcacattggtataagatgccgcttcaacccacttggtgaagtagtcaat 21679566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 29660192 - 29660367
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||    
29660192 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttattct 29660291  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
29660292 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 29660367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 48470965 - 48470790
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
48470965 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttgctgggaacaccatatcgacagatgatgttgttct 48470866  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
48470865 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 48470790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 5604536 - 5604711
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||    
5604536 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaataatcttactgggaacaccatatcggcagatgatgttgttct 5604635  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5604636 tgataaacttagctactacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 5604711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 6206942 - 6206767
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||    
6206942 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctggggacaccatatcgacatatgatgttgttct 6206843  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
6206842 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 6206767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 5472026 - 5471851
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||    
5472026 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcggcatatgaggttgttct 5471927  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
5471926 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 5471851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 8001598 - 8001423
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||    
8001598 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccgttgtcggtaataatcttgctgggaacaccatatcgacagatgaggttgttct 8001499  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||    
8001498 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcgacccacttggtgaagtagtcaat 8001423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 8216672 - 8216497
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||  ||||||||||||||||||||||||||||||| ||||||||||| |    
8216672 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcaataataatcttgctgggaacaccatatcgacatatgatgttgtttt 8216573  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
8216572 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 8216497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 10648111 - 10647936
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||    
10648111 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccgttgtcggtaataatcttgctgggaacaccatatcgacagatgaggttgttct 10648012  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||    
10648011 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcgacccacttggtgaagtagtcaat 10647936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 35885804 - 35885629
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||| ||||||||||| || |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||    
35885804 aattcttcacaaagagcctgcaccacattgttgttcaggttggtaccattgtcagtaatgatcttgctgggaacaccatatcgacagatgatgttattct 35885705  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
35885704 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 35885629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 4791857 - 4792032
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||  || |||||||| ||||||||||||||||  || |||||||||||||||||||||||||||||||||||||    
4791857 aattcttcacaaagagcttgcaccacatcgttgttcaggtttgtaccattgtcggtaaggattttgctgggaacaccatatcgacagatgatgttgttct 4791956  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
4791957 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 4792032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 17972083 - 17972258
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| || || || |||||||||||||    
17972083 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccgtaccggcatatgatgttgttct 17972182  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
17972183 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 17972258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 18056300 - 18056125
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    |||||||| |||||||||||||||||||| || |||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||    
18056300 aattcttcgcaaagagcttgcaccacattgttgttcaggtttgtaccattgtcggtaatgatcttgctgggaacaccataccgacagatgatgttattct 18056201  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
18056200 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 18056125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 32295666 - 32295491
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| || || || |||||||||||||    
32295666 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcggtaataatcttgctgggaacaccgtaccggcatatgatgttgttct 32295567  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
32295566 tgataaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccacttggtgaagtagtcaat 32295491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 28111176 - 28111351
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||| ||||||||||||||||||||||| || |||||||||||||    
28111176 aattcttcacaaagagcttgcaccacattgttgttcaggttggtaccattgtcagtaatgatcttgctgggaacaccatatcggcatatgatgttgttct 28111275  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||    
28111276 tgataaacttagctaccacttgcttggtcacattggtataagatactgcttcaacccacttggtgaagtagtcaat 28111351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 16619712 - 16619887
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||     
16619712 aattcttcacaaagagcttgcaccacattgttgtttaggttggtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttcc 16619811  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||| ||||||||||||||||| ||||||| ||| ||||| |||||||||||||||||  ||||||||||    
16619812 tgatgaacttggctaccacttgcttggttacattggcataggatgcagcttcaacccatttggtgtagtagtcaat 16619887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 19699527 - 19699353
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttct 102  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||     
19699527 aattcttcacaaagagcttgcaccacattgttgttcaggttagtaccattgtcggtaatgatcttgctgggaacaccatatcgacagatgatgttgttcc 19699428  T
103 tgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||||| | ||| |||||| |||| ||||||||||||||||| ||||| ||||||||||| ||||| |||||    
19699427 tgatgaactt-ggtacgacttgcatggttacattggtataagatgccgcttcgacccatttggtgaagtaatcaat 19699353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 3 - 72
Target Start/End: Complemental strand, 16421223 - 16421154
Alignment:
3 aattcttcacaaagagcttgcaccacattattattcaggttggtaccattgtcggtaataatcttgctgg 72  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||| ||||||||||    
16421223 aattcttcacaaagagcttgcaccacattgttgttcaggtttgtaccattgtcggtaatgatcttgctgg 16421154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 50; E-Value: 7e-20
Query Start/End: Original strand, 45 - 178
Target Start/End: Complemental strand, 4451747 - 4451614
Alignment:
45 gtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtcacattggtataag 144  Q
    |||||||| || || || |||||| | || |||||||| ||| | ||||| ||||||||||| |||    | ||||||||||||||||||||||||||||    
4451747 gtaccattatccgtgatgatcttgttagggacaccatagcgatatatgatattgttcttgataaaccggaccaccacttgcttggtcacattggtataag 4451648  T
145 atgctgcttcaacccatttggtaaagtagtcaat 178  Q
    | || ||||||||||| ||||| |||||||||||    
4451647 aagccgcttcaacccacttggtgaagtagtcaat 4451614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 45; E-Value: 7e-17
Query Start/End: Original strand, 70 - 166
Target Start/End: Complemental strand, 6573301 - 6573205
Alignment:
70 tgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggt 166  Q
    |||||||||| || || | |||||||||||||||||| || ||  | || || |||||||||||||||| ||||||||||||||||||||| |||||    
6573301 tgggaacaccgtagcggctgatgatgttgttcttgataaatttgaccactacctgcttggtcacattggcataagatgctgcttcaacccacttggt 6573205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 63 - 178
Target Start/End: Original strand, 6961739 - 6961854
Alignment:
63 atcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatt 162  Q
    |||||| ||||||| ||||| || || ||||| ||||||||||| ||     |||| ||||| ||||||||||||| ||||||||| ||||| |||||||    
6961739 atcttgttgggaacgccataacggcatatgatattgttcttgataaatcggactactacttgtttggtcacattggcataagatgccgcttcgacccatt 6961838  T
163 tggtaaagtagtcaat 178  Q
    |||| |||||||||||    
6961839 tggtgaagtagtcaat 6961854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 20445035 - 20444956
Alignment:
99 ttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggtaaagtagtcaat 178  Q
    |||||||| |||||  ||||||| |||||||||||||| | ||||||||| ||||||||||||||||| || ||||||||    
20445035 ttcttgataaacttgactaccacctgcttggtcacattagcataagatgcagcttcaacccatttggtgaaatagtcaat 20444956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 166
Target Start/End: Original strand, 7087357 - 7087453
Alignment:
70 tgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtcacattggtataagatgctgcttcaacccatttggt 166  Q
    |||||||||| || || | |||||||||||||||||| || ||  | || || ||||||||||||||||  |||||||||||||||||||| |||||    
7087357 tgggaacaccgtagcggctgatgatgttgttcttgataaatttgaccactacctgcttggtcacattggcgtaagatgctgcttcaacccacttggt 7087453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 166
Target Start/End: Complemental strand, 22961437 - 22961304
Alignment:
33 ttattcaggttggtaccattgtcggtaataatcttgctgggaacaccatatcgacagatgatgttgttcttgatgaacttagctaccacttgcttggtca 132  Q
    |||||||| || || |||||||| || || ||  || |||||||||| || || | ||||| |||||||||||| ||  |  | || || ||||||||||    
22961437 ttattcagatttgtgccattgtctgtgatgattctgttgggaacaccgtagcggctgatgaggttgttcttgataaatctgaccactacctgcttggtca 22961338  T
133 cattggtataagatgctgcttcaacccatttggt 166  Q
    |||||| ||||||||||||||||||||| |||||    
22961337 cattggcataagatgctgcttcaacccacttggt 22961304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 34; E-Value: 0.0000