View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_15_70 (Length: 237)

Name: J5_15_70
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_15_70
J5_15_70
[»] chr8 (10 HSPs)
chr8 (74-237)||(475272-475435)
chr8 (99-235)||(457632-457768)
chr8 (1-79)||(475431-475509)
chr8 (107-214)||(449348-449455)
chr8 (12-79)||(457781-457848)
chr8 (114-211)||(468757-468854)
chr8 (113-213)||(480773-480873)
chr8 (2-47)||(480894-480939)
chr8 (2-53)||(468877-468928)
chr8 (2-79)||(449475-449552)
[»] chr2 (2 HSPs)
chr2 (107-211)||(27489864-27489968)
chr2 (2-53)||(27489790-27489841)


Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 10)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 74 - 237
Target Start/End: Original strand, 475272 - 475435
Alignment:
74 attaatacacnttgagtggcctaatttgtaataaataaatacattttgcagggaattatggggtctgcatttgtattttgtctccaagcatggtgcatta 173  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
475272 attaatacacattgagtggcctaatttgtaataaataaatacattttgcagggaattatggggtctgcatttgtattttgtctccaagcatggtgcatta 475371  T
174 caaagagaggacctctcttctctgcagtgtttagtcctctcttaacaattcttgtgactatatt 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
475372 caaagagaggacctctcttctctgcagtgtttagtcctctcttaacaattcttgtgactatatt 475435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 99 - 235
Target Start/End: Original strand, 457632 - 457768
Alignment:
99 ttgtaataaataaatacattttgcagggaattatggggtctgcatttgtattttgtctccaagcatggtgcattacaaagagaggacctctcttctctgc 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
457632 ttgtaataaataaatacattttgcagggaattatggggtctgcatttgtattttgtctccaagcatggtgcattacaaagagaggacctctcttctctgc 457731  T
199 agtgtttagtcctctcttaacaattcttgtgactata 235  Q
    | |||||| ||||||||||||| |  |||||||||||    
457732 aatgtttaatcctctcttaacagtgattgtgactata 457768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 475431 - 475509
Alignment:
1 atattggctgtcttgttgcttcatgaggaaatatacattggaaggtactaatatttatgttctaaaaataaagattaat 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
475431 atattggctgtcttgttgcttcatgaggaaatatacattggaaggtactaatatttatgttctaaaaataaagattaat 475509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 107 - 214
Target Start/End: Original strand, 449348 - 449455
Alignment:
107 aataaatacattttgcagggaattatggggtctgcatttgtattttgtctccaagcatggtgcattacaaagagaggacctctcttctctgcagtgttta 206  Q
    |||||||| ||||| |||||||||||||| || ||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||    
449348 aataaatatatttttcagggaattatgggatcagcagttttattttgtctccaagcatggtgcattaaaaagagaggacctctcttctctgcaatgttta 449447  T
207 gtcctctc 214  Q
    ||||||||    
449448 gtcctctc 449455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 12 - 79
Target Start/End: Original strand, 457781 - 457848
Alignment:
12 cttgttgcttcatgaggaaatatacattggaaggtactaatatttatgttctaaaaataaagattaat 79  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
457781 cttgctgcttcatgaggaaatatacattggaaggtactaatatttatgttctaaaaataaatattaat 457848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 114 - 211
Target Start/End: Original strand, 468757 - 468854
Alignment:
114 acattttgcagggaattatggggtctgcatttgtattttgtctccaagcatggtgcattacaaagagaggacctctcttctctgcagtgtttagtcct 211  Q
    |||||||||||||| ||||||| |||||| |  |||  ||||||||||||||||||||| ||| |||||||||||||||||||||  |||||| ||||    
468757 acattttgcagggagttatgggatctgcagtaatatactgtctccaagcatggtgcatttcaaggagaggacctctcttctctgctatgtttactcct 468854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 113 - 213
Target Start/End: Original strand, 480773 - 480873
Alignment:
113 tacattttgcagggaattatggggtctgcatttgtattttgtctccaagcatggtgcattacaaagagaggacctctcttctctgcagtgtttagtcctc 212  Q
    ||||||||| ||||||| ||||| |||||| |   ||| | ||| ||||||||||||||| |||||||||||||||||||||||||  |||||| |||||    
480773 tacattttgtagggaatcatgggatctgcagtaacattctatcttcaagcatggtgcatttcaaagagaggacctctcttctctgctatgtttaatcctc 480872  T
213 t 213  Q
    |    
480873 t 480873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 2 - 47
Target Start/End: Original strand, 480894 - 480939
Alignment:
2 tattggctgtcttgttgcttcatgaggaaatatacattggaaggta 47  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||    
480894 tatttgctatcttgttgcttcatgaggaaatatacattggaaggta 480939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 2 - 53
Target Start/End: Original strand, 468877 - 468928
Alignment:
2 tattggctgtcttgttgcttcatgaggaaatatacattggaaggtactaata 53  Q
    ||||||||| | | |||||||||||||||||||||||||||||||| |||||    
468877 tattggctgccattttgcttcatgaggaaatatacattggaaggtagtaata 468928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 2 - 79
Target Start/End: Original strand, 449475 - 449552
Alignment:
2 tattggctgtcttgttgcttcatgaggaaatatacattggaaggtactaatatttatgttctaaaaataaagattaat 79  Q
    ||||||||  |||||| ||||||||||| |||||||  |||||||| ||||||||| ||||||| ||| | |||||||    
449475 tattggcttccttgtttcttcatgaggagatatacaccggaaggtattaatatttaagttctaacaatgatgattaat 449552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 107 - 211
Target Start/End: Complemental strand, 27489968 - 27489864
Alignment:
107 aataaatacattttgcagggaattatggggtctgcatttgtattttgtctccaagcatggtgcattacaaagagaggacctctcttctctgcagtgttta 206  Q
    ||||||||||||||| ||||| ||||||| || ||| | |  || ||||||||||||||||||||| |||  ||||||||||| ||||||||  ||||||    
27489968 aataaatacattttgtagggagttatgggatccgcagtagccttgtgtctccaagcatggtgcatttcaagaagaggacctctattctctgctatgttta 27489869  T
207 gtcct 211  Q
     ||||    
27489868 ctcct 27489864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 2 - 53
Target Start/End: Complemental strand, 27489841 - 27489790
Alignment:
2 tattggctgtcttgttgcttcatgaggaaatatacattggaaggtactaata 53  Q
    |||| ||||| |||||||||||||||||| |||||||||||||||| |||||    
27489841 tattagctgttttgttgcttcatgaggaagtatacattggaaggtagtaata 27489790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 315639 times since January 2019
Visitors: 447