View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_15_71 (Length: 325)

Name: J5_15_71
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_15_71
J5_15_71
[»] chr4 (3 HSPs)
chr4 (1-264)||(35365832-35366095)
chr4 (3-264)||(35373853-35374114)
chr4 (259-325)||(35366280-35366346)


Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 35366095 - 35365832
Alignment:
1 tgatttagtgcagaccaacctatanagaacaagttctatggaaataagcataagaagtgcaacnaaagaagcaatcgaaaaaanaaatggatcaaaattg 100  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||| ||||||||||||||||    
35366095 tgatttagtgcagaccaacctatacagaacaagttctatggaaataagcataagaaatgcaacaaaagaagcaattgaaaaaataaatggatcaaaattg 35365996  T
101 gagtgcatttgcagtggacagagtggtgcaaacagatcatgtcgacattgttttatgagacaagtctctagncagcttcagaatgctggttttaacngtg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||    
35365995 gagtgcatttgcagtggacagagtggtgcaaacagatcatgtcgacattgttttatgagacaagtctctagccagcttcagaatgctggttttaacagtg 35365896  T
201 ccatttgtaatactaaatggataaattcatatactcttcnatnngggaatttcanttgattaat 264  Q
    ||||||||||||||||||||||||||||||||||||||| ||  || ||||||| |||||||||    
35365895 ccatttgtaatactaaatggataaattcatatactcttccatcaggtaatttcatttgattaat 35365832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 3 - 264
Target Start/End: Complemental strand, 35374114 - 35373853
Alignment:
3 atttagtgcagaccaacctatanagaacaagttctatggaaataagcataagaagtgcaacnaaagaagcaatcgaaaaaanaaatggatcaaaattgga 102  Q
    |||| |||||||| |||||||| |||||||||||| | |||||||||||||| | |||||| ||||||||||| ||  ||| | || |||||||||| ||    
35374114 attttgtgcagacaaacctatatagaacaagttctgttgaaataagcataaggaatgcaacgaaagaagcaattgaggaaatagatagatcaaaattaga 35374015  T
103 gtgcatttgcagtggacagagtggtgcaaacagatcatgtcgacattgttttatgagacaagtctctagncagcttcagaatgctggttttaacngtgcc 202  Q
    |||   ||| ||| |||||||||||| |  |||||| |||| | | ||||| |||||||||||||||||  | ||||| |||| |||||||||| |||||    
35374014 gtgttgttgtagtagacagagtggtgaagccagatcttgtccaaactgtttcatgagacaagtctctagctaccttcaaaatggtggttttaacagtgcc 35373915  T
203 atttgtaatactaaatggataaattcatatactcttcnatnngggaatttcanttgattaat 264  Q
    ||||||||||||||||||| || |||| ||| ||||| ||  || ||||| | || ||||||    
35373914 atttgtaatactaaatggacaagttcacataatcttccatcaggtaatttaatttaattaat 35373853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 259 - 325
Target Start/End: Complemental strand, 35366346 - 35366280
Alignment:
259 attaattgtgtttttatttattttcntcntgngnnaataggtttttatttcnaaactataaccttga 325  Q
    ||||||||||||||||||||||||| || || |  |||||||||||||||| |||||||||||||||    
35366346 attaattgtgtttttatttattttcttcttgtgctaataggtttttatttctaaactataaccttga 35366280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 203957 times since January 2019
Visitors: 1517